1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Harlamova29_29 [7]
2 years ago
14

1. How does the marine biome retain its salinity?

Biology
1 answer:
lesya692 [45]2 years ago
5 0

Answer:

when marine water evaporates

You might be interested in
True or False: With the exception of three terminator codons and a stop codon, all
White raven [17]

it's true not falseeeeeee

8 0
2 years ago
How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
Mariana [72]

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

6 0
3 years ago
What molecule do plants pull from the air that is used to make sugar?
Mrac [35]

Answer:

carbon dioxide

Explanation:

its yummy for the tummy

7 0
3 years ago
Read 2 more answers
Why is it colder in winter than summer?
iragen [17]
One reason is because the short days and long nights prevent the earth from warming up, another reason could be because the sun's rays in winter are more spread out thus minimizing the amount of energy
6 0
3 years ago
Read 2 more answers
During a marathon, runners draw heavily on their internal reserves of glycogen (carbohydrate) and triglycerides (fat) to fuel mu
g100num [7]

Answer:

The activity of cyclic AMP phosphodiesterase is prevented by caffeine. The caffeine prevents further dissociation of cAMP, which eventually increases the response within the body. The activity of neurotransmitters, that is, of noradrenaline or epinephrine, gets increased due to enhancement in response.  

This further enhances the activity of the heart, the rate of muscle contractions, blood pressure that further helps in delivering more oxygen to the brain, and other parts of the body. Thus, the inhibition of the enzyme cyclic AMP phosphodiesterase helps the athletes to prevent the wall.  

7 0
3 years ago
Other questions:
  • Identify two characteristics of the inner layer of the eye
    11·2 answers
  • Which of the following is not a function of the circulatory system?
    14·1 answer
  • The "permanent" wave that your local beauty parlor offers depends critically on rearrangements in the extensive disulfide bonds
    5·1 answer
  • Why do animals need a regular supply of carbohydrates?
    14·1 answer
  • A type of forest characterized by trees that seasonally shed their leaves is referred to as a __________.
    15·2 answers
  • What do cells need to do between divisions to make sure they don't just get smaller and smaller.
    6·1 answer
  • I need help in bio it’s due tomorrow pleaseee
    15·2 answers
  • The messages that scientists are sending into space are directed at intelligent alien life. Do
    10·1 answer
  • 3. Your body needs protein. Protein is broken down into amino acids that are then used to build the
    10·1 answer
  • Which piece of spectral data is necessary to determine the spectral class of a star?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!