1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Harlamova29_29 [7]
2 years ago
14

1. How does the marine biome retain its salinity?

Biology
1 answer:
lesya692 [45]2 years ago
5 0

Answer:

when marine water evaporates

You might be interested in
What can you determine by looking at the data on the chart?
kirill115 [55]
What’s is the cart to this problem?
4 0
3 years ago
Read 2 more answers
Which of the following would cause an error in DNA replication?
GaryK [48]

Answer: I believe it is A. DNA polymerase checking the DNA

8 0
3 years ago
Grassland ecosystems receive very little precipitation. The predominant plants are grasses, and drought and wildfire are common.
elixir [45]
Hi hope I can help, I think the answer isB
3 0
3 years ago
During a windstorm, a large old tree fell in the forest. As it came down, it trapped a young sapling about 5 meters tall underne
IgorC [24]
During a windstorm, a large old tree fell in the forest. As it came down, it trapped a young sapling about 5 meters tall underneath it. The top of the 

Auxin and gibberellin in the sapling's stem will cause a gravitropic response in the sapling, and its stop will grow upward even though it is held down. 
5 0
3 years ago
Read 2 more answers
long thin shape for carrying messages around body, many branches to communicate with other nerve cells. What cell is it?
iren [92.7K]

Answer:

It is a Neuron cell

Hope it helps..........

3 0
3 years ago
Other questions:
  • The nitrogenous bases guanine and adenine are
    10·2 answers
  • Do sharks have bacteria in their stomach that let them digest their food
    8·2 answers
  • fungal and protist infections, especially those that are deeper than the skin, are especially hard to treat. why?​
    6·1 answer
  • A circular molecule of DNA contains 1 million base pairs. If the DNA synthesis at a replication fork occurs at a rate of 100,000
    5·1 answer
  • Low genetic diversity in a population can lead to
    13·1 answer
  • What is the primary source of energy in a food change
    8·1 answer
  • (GIVING BRAINLIEST!!)
    14·2 answers
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Identify TWO density-dependent factors that could act as limiting factors for a population. Why are they density-dependent? Plea
    8·1 answer
  • Which stem adaptation is most helpful in protecting a plant from disease
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!