1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alexeev081 [22]
2 years ago
7

Question 10 of 10

Biology
1 answer:
Murljashka [212]2 years ago
7 0

Answer:

C. Eliminating government funding of research.

Explanation:

Government funding is the backbone for new research and discoveries in any country. Without government funding, the number of discoveries and technology will decline drastically because research requires lots of money which every private organization may not be able to provide.

You might be interested in
What does this diagram represent?
Korolek [52]
It represents DNA since it is double stranded.
5 0
3 years ago
Allele Synonyms??? and Antonyms
klemol [59]

Explanation is in the file

tinyurl.com/wtjfavyw

7 0
3 years ago
1.Can two individuals from different subspecies interbreed? Explain your answer
Katena32 [7]
2. the inability to adapt to its environment. if a bird lives in a tree and itgets cut down it has to find a new tree. it has to adapt..find a new habitat. if it can't do that, it has no shelter and dies
4 0
4 years ago
What do you need to conduct an experiment
lidiya [134]
Depends on what you are trying to test.
6 0
3 years ago
The less common type of plant is the _____. hydrophytes mesophytes xerophytes
AysviL [449]
The correct answer is:  [C]:  "xerophytes" .
_____________________________________________________
3 0
3 years ago
Other questions:
  • Please help! ♥
    7·2 answers
  • Where would a probe with the sequence AATCG bind to a target DNA with the sequence TTTTAGCCATTTACGATTAATCG (recall that DNA sequ
    12·1 answer
  • What are the 8 cranial bones?
    15·2 answers
  • Which statement about the knee is incorrect? a. Several ligaments cross the knee to stabilize the knee in several directions. b.
    8·1 answer
  • Which of the following climographs (City A or City B) represents a desert location? How do you know?
    9·1 answer
  • Show the location of different parts of the urinary system in man
    6·1 answer
  • James has been having trouble digesting lean steaks and other protein-rich foods, and these foods seem to stay in his stomach lo
    6·1 answer
  • What are three diseases/disorders caused by mutations?​
    5·1 answer
  • Evolution assessment tibetan plateau
    14·1 answer
  • Plants have an added layer that animal cells do not. What is that added layer called?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!