1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mamont248 [21]
4 years ago
12

Where would a probe with the sequence AATCG bind to a target DNA with the sequence TTTTAGCCATTTACGATTAATCG (recall that DNA sequ

ences are always written 5' to 3')?
Biology
1 answer:
Pani-rosa [81]4 years ago
4 0
The probe would need to bind to the site
<span>TTTTAGCCATTTACGATTAATCG

The sites that are bold are were the probe need to bind in order to target the DNA. The sequence of the prob needs a site that is </span><span>complementary and antiparallel to it.</span>
You might be interested in
Why is the origin of the universe still a question
shusha [124]

because different scientists have different theories or explainatons on how the universe came into being so that's why the origin of the universe is still a question

hope this helps

4 0
3 years ago
Why does salad wilts as soon as salt is added?
Musya8 [376]
The salt takes the water from the salad.

6 0
3 years ago
Give an example of an organ that is included in more than one organ system. How does the organ's functions offer a unique contri
MAXImum [283]

Answer:

The correct answer is - ovaries.

Explanation:

Ovaries are organ which plays a distinct role in two different organ system and both roles of the organ are essential. Ovaries not only produces egg in the reproductive system but also produces the hormone which is part of the endocrine system.

The endocrine system is a system of chemical messengers which depends on the feedback loop to release the chemical messenger or hormone directly to the circulatory system, ovaries are part of this system as it produces a hormone.

7 0
3 years ago
What is the function of the middle ear?
zhannawk [14.2K]

Answer:

to transform sound waves into mechanical vibrations

Explanation:

it's function is

8 0
2 years ago
Which part of the neuron contains the nucleous
Viktor [21]

The main portion of the cell is called the soma or cell body. It contains the nucleus, which in turn contains the genetic material in the form of chromosomes. Neurons have a large number of extensions called dendrites.

4 0
3 years ago
Other questions:
  • Which of the following is TRUE of species interactions?A) They can act as agents of natural selection.B) The outcome of any spec
    5·1 answer
  • Proteins involved in facilitated diffusion are
    11·1 answer
  • If a gamete contains 5 chromosomes, how many chromosomes will a typical body cell contain? does the number of chromosomes change
    9·1 answer
  • Why is bacteria good for copying large amounts of DNA?
    11·2 answers
  • Complete the sentences by matching the names of trees to the appropriate blanks. to do this, drag the names on the left into the
    10·1 answer
  • Two organisms are shown in the diagram below.
    13·2 answers
  • Without(blank)
    6·2 answers
  • Letter E. What is the tissue called?
    13·1 answer
  • How similar are daughter cells to each other and to the orginal parent cell?
    8·1 answer
  • What are the three tasks that DNA must be able to perform in all organisms?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!