1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Dmitry_Shevchenko [17]
2 years ago
12

Androgens are hormones that promote the development of ________ characteristics.

Biology
1 answer:
ivanzaharov [21]2 years ago
4 0

Androgens are hormones that promote the development of male characteristics.

<h3>What are Hormones?</h3>

These are chemical messengers which are secreted into the blood for different functions in the body.

Androgens are sex hormones which are involved in the development of the male reproductive system.

Read more about Androgens here brainly.com/question/7030072

#SPJ1

You might be interested in
Can anyone help me with this
Umnica [9.8K]
Yea it's 60° my dude
5 0
3 years ago
Read 2 more answers
How can alleles that cause serious diseases, such as sickle cell disease, still provide an advantage to the human population?
Elden [556K]

Certain alleles may cause serious diseases in a given environment but they may also be beneficial in different environmental conditions. It is a principle of natural selection.

<h3>Natural selection and alleles</h3>

Natural selection refers to the differential survival and reproduction of an organism in a given environment.

Certain alleles such as the allele of sickle cell disease show an evolutionary advantage in specific environmental conditions.

This allele is lethal in homo-zygous individuals, thereby tending to be eliminated from the population.

However, in regions where malaria is endemic, the presence of carriers individual having the sickle cell allele is advantageous to prevent this disease.

Learn more about natural selection here:

brainly.com/question/1657375

7 0
2 years ago
Financial freedom comes from owing money to just family members but not owing anything to friends. True or False????
gayaneshka [121]
False, financial freedom is not owing anyone money.
7 0
2 years ago
Which of the following statements about soil formation is true?
Kisachek [45]

B. Precipitation affects the rate at which nutrients are removed from soil.

Soil is known to be a loose mixture of rock fragments, water, organic materials and air that  usually accommodate the growth of vegetation. Thus, formation and development of soil is a dynamic process rather than static and soil is present when pre-historic animals roamed the Earth and some these animals are preserved only fossilized soils buried deep beneath our present soil.

6 0
2 years ago
Read 2 more answers
What do cyclins regulate?
GalinKa [24]

Answer:

Cyclin is a family of proteins that controls the progression of a cell through the cell cycle by activating cyclin-dependent kinase (CDK) enzymes or group of enzymes required for synthesis of cell cycle.

5 0
2 years ago
Read 2 more answers
Other questions:
  • Can someone help me ??
    12·1 answer
  • Where does a point lie if it is on a segment whose endpoints are on the sides of the angle, but it is not an endpoint of the seg
    8·1 answer
  • Which biome would you find the most variety of life
    11·2 answers
  • PLEASE HELP ME!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!11111!
    9·1 answer
  • Does anybody know the spesific island within the galapagos islands the marine iguanas inhabit?
    15·2 answers
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • If your body lacks enzymes that break down carbohydrates, it would be unable to get __A__ for energy production. If you lacked t
    10·1 answer
  • Nitrogenous base + sugar + phosphate group =
    5·2 answers
  • 16. variables that are kept the same in all groups
    12·1 answer
  • If a secondary consumer had 3 million calories of energy, how many calories are available to the tertiary consumer?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!