1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Varvara68 [4.7K]
2 years ago
10

If the DNA sequence is CCAATTGA, what is the compliment? I need this fast

Biology
1 answer:
Over [174]2 years ago
7 0

Answer: GGTTAACT

Explanation:

You might be interested in
When organisms ingest food, the food is converted into which substance?
sertanlavr [38]
I would have to go with A
6 0
3 years ago
Which of the following is a characteristic of hydrologic fracturing?
jeyben [28]

Answer:

<u>A. Large amounts of water force open cracks in rocks</u>

Explanation:

Hydraulic fracturing, or fracking, is a drilling method used to extract petroleum (oil) or natural gas from deep in the Earth. In the fracking process, cracks in and below the Earth's surface are opened and widened by injecting water, chemicals, and sand at high pressure.

A is basically explaining this the same way. Forcing cracks in the ground with liquids.

Hopefully I was a help to you. If not I am sorry and I wish you the most wonderful of days. :)

3 0
3 years ago
What does the first law of thermodynamics state ?
REY [17]
The total energy from an isolated system is constant; energy can be changed from one form to another, but can't be created or destroyed.
4 0
4 years ago
What is chyclomicrons?​
scZoUnD [109]

<u>Answer:</u>

<em>Chyclomicrons is a little fat globule made out of protein and lipid.</em>

<u>Explanation:</u>

It is found in the blood and lymphatic liquid where they circle fat from its port of passage was given  in the digestive tract to the Liver and fat tissue. When we take a greasy dinner the blood is satisfied with chyclomicrons.

It looks so smooth. The CM leeway rate is quick, the half-life is 10 minutes, and the ordinary human can not be recognized following 12 hours on fasting.

5 0
3 years ago
Researchers have recently sequenced the genetic identities of nine ancient fully modern H. sapiens from sites in Italy, France,
dem82 [27]

Answer: D

Explanation:

8 0
3 years ago
Other questions:
  • Explain how fossil hunters can be good stewards.
    10·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • Two purple flowers (Bb) are bred with each other in the same garden. What are the odds that red (BB) and blue (bb) flowers will
    15·1 answer
  • Sulfur dioxide emitted from power plants eventually causes acid rain in the atmosphere. Which term best describes acid rain?
    11·1 answer
  • Which of the following is an example of a keystone species? (select all that 2 points
    10·1 answer
  • Is glycerol an atom?
    15·1 answer
  • Determine the temperature of the bar on the fahrenheit scale.
    10·1 answer
  • Both get something from the relationship. The fungus gets (4..................................) and (5..........................
    6·1 answer
  • 10 An enzyme in potato cells causes oxygen to be produced from hydrogen peroxide.
    8·1 answer
  • 30. The sweeper tentacles of corals contain:
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!