1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Aleksandr [31]
3 years ago
13

What is the definition for Allele?

Biology
2 answers:
Bumek [7]3 years ago
5 0

Explanation:

One of a number of alternative forms of the same gene occupying a given position, or locus, on a chromosome is allele.

bearhunter [10]3 years ago
5 0

Explanation:

one of two or more alternative forms of a gene that arise by mutation and are found at the same place on a chromosome

You might be interested in
a. A breakdown of U.S. household garbage reveals the largest amount percentage-wise is paper and paperboard. b. In U.S. househol
Alex17521 [72]

Answer:

c. The founder of the modern environmental movement and author of Silent Spring is Rachel Carson

d. Deciduous trees such as most pines do not lose their leaves/foliage in winter.

Explanation:

Yes, Rachel Carson is the founder of the modern environmental movement as well as author of Silent Spring. She was an American marine biologist, author, and conservationist which started the modern environmental movement in order to save the environment form pollution. Yes, the Deciduous trees such as most pines do not lose their leaves/foliage in winter, they only lose those leaves that are too old. They are considered as evergreen plants.

8 0
2 years ago
List the 3 stages of cellular respiration.
Contact [7]
The three main stages of cellular respiration (aerobic) would include Glycolysis, the Kreb's Cycle and the Electron Transport Chain. The Krebs Cycle takes Citric Acid which is a derivative of Pyruvic Acid and converts this through 4 cycles into Hydrogen, carbon dioxide and water in the Mitochondrial Matrix.
5 0
2 years ago
Read 2 more answers
What type of fungi is most closely related to club fungi?
abruzzese [7]

What type of fungi is most closely related to club fungi?

\longrightarrow{\pink{a.\:Sac \:fungi}} ✅

Club fungi is most closely related to sac fungi.

\bold{ \green{ \star{ \orange{Mystique35}}}}⋆

8 0
2 years ago
At a seismic station, s-waves arrive first, followed by p-waves second.
Jet001 [13]
Actually, it is false. P-waves arrive first and then S-waves arrive.
6 0
3 years ago
The impact of genes on observable traits can vary in different environments. thus, genes are said to be:
blondinia [14]
They can be self-regulating. 
4 0
3 years ago
Other questions:
  • What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
    14·2 answers
  • Jordan's grandmother uses the juice from squeezed lemons to remove stains from his shirt. He hypothesizes that the juice is the
    11·1 answer
  • Which of the following is true of fertilization in conifer? Please don't copy and paste I needed actual help from someone who kn
    12·2 answers
  • Explain the process of mitosis in a tissue culture for normal cells.
    14·1 answer
  • Why maize is considered a staple crop?
    14·1 answer
  • "While bird watching, Carl hypothesized he could identify 73 different types of birds in one day. He actually identified 65 diff
    15·1 answer
  • How many lymph nodes are in the body? what is the function of the lymph nodes?
    7·1 answer
  • True or false: Chloroplasts contain green chlorophyll and are
    15·1 answer
  • Remembering the function of chloroplasts, in which part(s) of the leaf is photosynthesis taking place​
    12·2 answers
  • Photosynthesis equation with explanation​
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!