Super heated liquid molten lava
Answer:
1) In mitosis, a single cell is divided into two daughter cells while in meiosis a single cell is divided into four daughter cells.
2) Mitosis occurs in body cells in which sperm and egg cells combine and make a diploid zygote while meiosis are present in sex cells in which haploid cells are produced.
3) In mitosis, the number of chromosome is double i. e. Diploid while in meiosis the number of chromosome is half i. e. haploid.
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
Answer:
u can find out The size of the seed
Based on the assessment of the newborn, it can be inferred that the newborn was fed with formula milk. Also, the baby demonstrates gastrointestinal functioning. Newborns experience a change in stool color and odor in the days after they were born. This indicates proper gastrointestinal functioning. The yellow color of the stool is due to the breakdown of bilirubin.
