Answer:
Louis Pasteur, by observing that the microbes were in the air and contaminated the broth helped determine that all the cells came from pre-existing cells (option b), one of the postulates of the cell theory.
Explanation:
Louis Pasteur's experiments, conducted around 1860, showed that unicellular organisms appeared in a culture broth only if it was exposed to the air, where other microorganisms were present, thus disproving the hypothesis of spontaneous generation.
On the other hand, in the broth that was not exposed to the air Pasteur did not observe microorganisms.
By rejecting the hypothesis of spontaneous generation through his experiment, Louis Pasteur reaffirmed the postulate of the cell theory that proposes that all cells come from preexisting cells.
The other options are not correct due to:
<em> a and c. </em><em><u>All animals are made of cells
</u></em><em> and </em><em><u>cell is the basic functional unit of living things</u></em><em> are postulates of the cellular theory that were not demonstrated by Pasteur's experiment.</em>
<em> d. </em><em><u>Unicellular organisms inherit an exact copy of DNA from the parent cell</u></em><em> is not a postulate of cell theory.</em>
True. The correct option is C.
<h3>Energy transfer in the ecosystem</h3>
Energy is transferred from lower to higher trophic levels of the food chain in any ecosystem.
In other words, energy is transferred when primary consumers feed on producers, when secondary consumers feed on primary consumers, and so on.
However, when energy is transferred through feeding from lower to higher trophic levels, a certain percentage of the energy is lost to the surroundings as heat.
In actual fact, scientists believe that about 90% (and not 30%) of the energy is lost as heat to the surrounding. Only about 10% of the energy is converted to useful energy.
More on energy transfer in the ecosystem can be found here: brainly.com/question/15896675
#SPJ1
Answer: The answer is B.
Explanation: The answer is B because the muscle tissues vary with function and location in the body.
Answer:
In muscle cell, fermetation produces <u>"lactate and NAD"</u>
<u>In fermentation Pyruvate is reduced and __NADH__ is oxidized.</u>
Explanation:
Muscle cells perform lactic acid fermentation when enough oxygen is not available to support aerobic cellular respiration. The process of glycolysis forms two molecules of pyruvate from one glucose molecule and uses NAD+ as electron acceptor. During lactic acid fermentation, pyruvate is reduced into lactate and NADH serves as an electron donor. The final products are lactate and NAD+. The reaction is catalyzed by lactate dehydrogenase enzyme. The NAD+ produced by fermentation is required to continue the process of glycolysis.
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
