1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
SpyIntel [72]
2 years ago
15

In comparison to the composition of carbohydrates and fats, which element found in proteins makes them unique?

Biology
1 answer:
worty [1.4K]2 years ago
3 0

Proteins are the only macronutrients that contain <u>nitrogen</u>, but carbohydrates, lipids, and proteins all contain the elements carbon, hydrogen, and oxygen.

  • Nitrogen is a naturally occurring element that is necessary for both plant and animal growth and reproduction.
  • It is present in many different chemical and inorganic compounds, including the amino acids that make up proteins, the nucleic acids that make up the genetic material and the blueprint for all organisms' viability.
  • High-protein, high-purine foods like beef, shellfish, and organ meat are among the foods that contain a lot of nitrogen.
  • For life to be nourished, renewed, and sustained, proteins are essential. Proteins contain the atoms carbon, hydrogen, and oxygen, much like carbohydrates and lipids do.

learn more about Proteins here: brainly.com/question/884935

#SPJ4

You might be interested in
The amount of energy transferred from the primary producer to the primary consumer is what?
Andreas93 [3]
 <span>10% 

Keep in mind the energy pyramid. 
90% energy is lost at each level approximately.</span>
6 0
3 years ago
Sarcomeres are functional units of ________ muscle.
poizon [28]

Answer:

Sarcomeres are functional units of skeletal muscle fiber.

Explanation:

Hope this helps!

3 0
2 years ago
Read 2 more answers
Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Alla [95]

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

8 0
2 years ago
Question 9 (1 point)
Dimas [21]

Answer:

True

Explanation:

It is true as in Mendel's law of inheritance

7 0
3 years ago
Read 2 more answers
How did the frameshift change the amino acids?<br> Please it’s due today
notka56 [123]
A single insertion or deletion of a nucleotide will basically lead to a frameshift mutation where the “reading frame” is disrupted. Normally, amino acids are encoded by three nucleotides, called a codon.
4 0
3 years ago
Other questions:
  • ________ – difficulty in passing current. work is done to pass through ________, releasing energy.
    7·1 answer
  • The process by which vesicles containing solid objects such as bacteria are fromed on the surface of a cell for transport into c
    7·1 answer
  • Which neurotransmitter is primarily responsible for the generation of behaviors observed during dowsing?
    15·1 answer
  • Other than passing genes from parents to offspring, bacteria are also capable of injecting their genes directly into other bacte
    15·1 answer
  • 1
    10·1 answer
  • Think about the volume of the stack. By definition, what is the volume of the stack equal to? Express you answer in words instea
    5·1 answer
  • which of these might be considered benefits of climate change scelect the two correct choices a. increase demand for building co
    11·1 answer
  • Plants store their nutrients, and water in their: A.nucleus B.vacuole C.chloroplasts D.cell membrane
    8·1 answer
  • In which kingdom do all organisms have cells that lack a cell wall?
    13·2 answers
  • Please heeelp
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!