1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lions [1.4K]
1 year ago
11

Jane purchased green light bulbs and blue light bulbs to help her house plants grow. What results would you expect her to see if

the green and blue bulbs are used in different rooms. Chrgg
Biology
1 answer:
Ganezh [65]1 year ago
6 0

If the green and blue bulbs are used in different rooms than plants with blue light bulb will grow faster than plants with green light bulb.

<h3>How Green and Blue light would affect plants?</h3>
  • Growing plants in green light would not give them enough energy since chlorophyll reflects green light, therefore the plant would not receive that energy.
  • An average plant's chlorophyll reflects green light while absorbing  blue light.
  • As a result, even though the plant would be receiving slightly less light in the blue room, it should still be able to thrive.
  • The plant shouldn't live in the green room because it would be consuming very little energy there.
  • The highest rate of photosynthesis will be produced by blue filter since they provide plants with the light spectrum they need for photosynthesis.

Learn more about photosynthesis here:

brainly.com/question/26494694

#SPJ4

You might be interested in
Which characteristic do ferns have that mosses do not?
ValentinkaMS [17]
Ferns are pointy and mosses is not!
6 0
3 years ago
Human blood types are characterized by the presence absence of surface markers known as a tigers on the surface of red blood cel
zalisa [80]

Answer:

characterized by presence or absence of antigens

the blood types are A, B, O, AB

Explanation:

There are two antigens and two antibodies that are mostly responsible for the ABO types.  The specific combination of these four components determines an individual's type in most cases. Erythrocytes and serum were related to the presence of antigens on these erythrocytes and antibodies in the serum. these antigens  are A and B, and depending upon which antigen the erythrocytes express, blood either belonged to blood group A or blood group B. A third blood group contained erythrocytes that reacted as if they lacked the properties of A and B, and this group was later called "O" blood group. The fourth blood group AB, was added to the ABO blood group system. These erythrocytes expressed both A and B antigens.

Blood group   Antigen present on RBC    Antibodies in serum    Genotype(s)

      A                        antigen A                             anti-B                     AA or AO

      B                        antigen B                             anti-A                     BB or BO

      AB              both A and B antigen                 none                         AB

      O                           none                           anti-A and anti-B           OO

4 0
3 years ago
What process of weathering causes rocks to change composition when reacting with oxygen?
hammer [34]
Mechanical weathering

3 0
3 years ago
Explain how visible inherited traits are diffrent amongst offspring of the same parent.
bonufazy [111]

Answer:

Although an individual gene may code for a specific physical trait, that gene can exist in different forms, or alleles. ... In other cases, each parent provides a different allele of a given gene, and the offspring is referred to as heterozygous ("hetero" meaning "different") for that allele.

5 0
2 years ago
Joanne is going out to her car after taking a night class, and just as she is about to open the car door, a man appears who has
Tanzania [10]

Answer:

D

because hes doing it for attention

4 0
2 years ago
Read 2 more answers
Other questions:
  • 1. In a certain plant population, yellow seed color is recessive to green seed color. If a yellow seeded plant is crossed with a
    13·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Demonstrate in a brief paragraph how the scientific method is used to help us understand the universe and the movement of planet
    15·1 answer
  • The process of _______ causes rocks to change composition when reacting with oxygen
    9·1 answer
  • Weather is made up of a variety of conditions in the atmosphere. It includes temperature, or the amount of ____ in the air, as w
    11·2 answers
  • It is necessary for the immune system to clearly distinguish foreign cells and proteins from those made by the body.
    15·1 answer
  • Put these time divisions in order, from longest to shortest. eon period epoch
    15·2 answers
  • What part of the body does cancer generally affect?
    13·2 answers
  • Mercury is found in a food chain. Which organism would have the highest concentration?
    15·1 answer
  • The common ancestors of birds and mammals were very early (stem) reptiles, which almost certainly possessed 3-chambered hearts.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!