1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
OLEGan [10]
1 year ago
10

The​ half-life of​ carbon-14 is 5600 years. If a piece of charcoal made from the wood of a tree shows only ​% of the​ carbon-14

expected in living​ matter, when did the tree​ die?.
Biology
1 answer:
Leokris [45]1 year ago
4 0

Mature and established trees die for a combination of reasons but sudden browning of foliage is typically associated with a lack of water supply to the canopy. Water supply can be cut off to the canopy due to obvious issues including deficiency or root damage.

<h3>What is Carbon?</h3>
  • Carbon is a chemical component with the symbol C and atomic number It is nonmetallic and tetravalent—its atom makes four electrons unrestricted to form covalent chemical bonds. It belongs to group 14 of the periodic table. Carbon produces up only about 0.025 percent of Earth's crust.
  • Carbon is employed in some way in almost every industry around the globe. It is used for fuel in the form of coal, methane gas, and crude oil (which is used to produce gasoline). It is used to make all sorts of fabrics including plastics and alloys such as steel (a mixture of carbon and iron).
  • Carbon is a chemical element with the symbol C and atomic number 6. Categorized as a nonmetal, Carbon is a solid at room temperature.

To learn more about Carbon, refer to:

brainly.com/question/1601509

#SPJ4

You might be interested in
Veronica wrote Charles Darwin’s main points on the board, but she made a mistake in one point.
Leno4ka [110]

<span>The question above is incomplete, the remaining part of the question is given below:
1. Since more offspring are produced than an environment can support, organisms within a population must compete for resources to survive.

2. Due to variations within the population, some competitors will be better equipped for survival than others.

3. The best-equipped organisms will survive and will produce well-equipped offspring. 

4. Variations that help with survival will be passed on to future generations and will rapidly change the whole population.

Which point is flawed as written above?
A. point 1
B. point 2
C. point 3
D. point 4</span>

ANSWER

The correct option is D.

All the options written above about Darwin's theory are quite correct with the exception of option D. Charles Darwin was the scientist who proposed the theory of evolution by mean of natural selection. Darwin submitted that, due to the scarcity of needed resources in an environment, it is only the fittest individuals in a particular population that will be able to survive and produce offspring that share their adaptability features. As this continue from generation to generation, it leads to evolution, which is defined as the changes overtime, which give rise to new species that share a common ancestors. Contrary to the point made in option D, evolution by natural selection is not a rapid process at all, it is a process that occur over a long period of time.

7 0
3 years ago
If you have an open cut, what statement explains the precaution you should take regarding swimming, and why this is necessary?
FromTheMoon [43]

Answer:

You should wash your cut before and after swimming so that bacteria in the water can't infect the wound.

Let me know if its right <3

4 0
3 years ago
. Which two biomes have the least precipitation?
gavmur [86]
"Tundra and desert" are the two biomes among the choices given in the question that <span>have the least precipitation. The correct option among all the options that are given in the question is the third option.

"Exposure to solar flares" is the one among the following choices given in the question that would not </span><span>be a factor that helps determine the characteristics of a land biome. The correct option among all the options given in the question is the first option.</span>
6 0
3 years ago
Read 2 more answers
Which processes will all living things use to maintain homeostasis
navik [9.2K]
The organism (Living thing), utilizes energy, can detect changes in the environment it is in, and can rearrange and synthesize chemical compounds. 

Some things to remember, Living organisms need to be able to reproduce, obtain energy, usually by eating food in order to work. They need the ability to maintain structure, a body. They need to be able to react to a change, whether it be external or internal. The organism must be able to dispose of waste. Needs the ability to grow and develop. Must be able to move. and finally death. <span />
4 0
3 years ago
both a father and child drink water that has flowed through lead pipes. there is also lead-based paint on the walls of their hom
Butoxors [25]
The child is more susceptible to diseases than the father because the father has already gained a slight immunity towards the lead by loving in the house longer than the child (assuming the father has lived in the house longer)
7 0
3 years ago
Other questions:
  • Most living organisms consist of more than 70% water by weight true or false
    14·2 answers
  • Name the most suitable apparatus for measuring exactly 1centimeter of hydrochloric acid​
    5·2 answers
  • In gymnosperms the mature seed in tucked inside
    14·1 answer
  • Bacteriophages are bacteria that cause diseases in commercially produced plants.
    5·1 answer
  • Hellpppp I’m in biology taking a test!!!!
    9·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Organic chemistry focuses on __________.
    13·1 answer
  • How are "bands" inherited?
    11·1 answer
  • When an organism encounters nitrate in its environment, which condition will determine whether the nitrate is used in an assimil
    5·1 answer
  • The author writes, “Gerardo Ceballos, a researcher at the Universidad Nacional Autonoma de Mexico in Mexico City, acknowledged t
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!