1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dem82 [27]
3 years ago
9

Discuss the three stages of interphase and the events which occur within each stage.

Biology
1 answer:
svetoff [14.1K]3 years ago
7 0

The three stages of interphase are G1, S and G2 phases.

Explanation:

The events that takes place before cell division is termed as interphase. It is the phase of preparing cell for division also called resting phase. Interphase of the cell is marked by DNA synthesis.

The cell cycle is basically divided into two discrete phases:

Interphase and mitosis

Interphase is further divided into 3 phases:

G1,S and G2 phases

G1 Phase or first gap phase: Cell size increases in this phase, organelles are made, enzymes for replication is synthesized, nutrients are stored and various molecular subunits synthesized as a preparatory measure for DNA replication.

S- PHASE or synthesis phase: Replication of DNA takes place in the cell nucleus, centrosome is duplicated for cell division in mitosis.

G-2 phase or second gap phase: The proteins required for cell division are synthesized, cell grows much bigger. It is an important checkpoint of cell growth. Cancer cells skip the G2 phase and gets uncontrolled division. Lysosomes and mitochondria multiply in this phase so as to divide in two cells. If repair in DNA is required it is done in this phase only.

You might be interested in
many organisms that undergo chemosynthesis use instead of to fuel the processes that convert carbon dioxide into sugars.
OLEGan [10]

Answer:

Many organisms that undergo chemosynthesis use hydrogen sulphide (H2S) instead of sunlight to fuel the processes that convert carbon dioxide into sugars.

Explanation:

Prokaryotic microorganisms, principally bacteria and archaea (referred to as “bacteria” in the following), carry out chemosynthetic reactions. Energy is produced in chemosynthetic reactions from oxidizing reduced compounds.

Chemosynthesis is the conversion of carbon (usually carbon dioxide or methane) into organic matter using inorganic molecules (hydrogen or hydrogen sulphide) or methane as an energy source. Most energy is initially derived from sunlight via plant photosynthesis. Example, bacteria and methanogenic archaea living in deep sea vents

Learn more about Chemosynthesis - brainly.com/question/14727352

#SPJ4

7 0
2 years ago
Upon examining a crime scene you don't locate any visible prints. To identify latent prints you will have to use a powder. There
shusha [124]
<span>1. The investigator should use fluorescent fingerprint powder, so that the prints will be visible on the dark surface when a special kind of light is used. 

2. A possible cause of death would be asphyxia, and is one of the most common causes of death that involve murder and violence. 

3. C. thin layer chromatography and Infrared spectrometry 

</span>
5 0
2 years ago
Read 2 more answers
Pick all the characteristics below that describe compounds
taurus [48]

Compounds are made up of two or more elements which are chemically bonded. The elements and the properties of the compound are different. Exposure to light and chemical reaction can break compounds into elements. Compounds are only chemically separated not physically. The mass of elements determined the mass of the compound.

6 0
3 years ago
If the inner lining of the air sacs is neither thin nor highly vascularized, then what can be inferred about the ai
MArishka [77]
If the inner lining of the air sacs neither thin nor highly vascularized, then it can be inferred that AIR SACS ARE CANNOT BE THE SITES OF GASEOUS EXCHANGE BETWEEN AIR AND BLOOD. Air sacs are generally lined with mucus and surrounded with blood capillaries.
In case of birds, air sacs play an important role in respiratory system.
4 0
3 years ago
Determine which scientist made each contribution
Pani-rosa [81]

Answer:

Pictures?

Explanation:

7 0
3 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Which of the following terms describes the distance between the crests of successive waves? Frequency Nanometer Trough Wavelengt
    5·2 answers
  • When an object moves in a circle,_____ acts to accelerate the object towards the center of that circle
    14·2 answers
  • Which two systems work together to deliver oxygen to cells throughout the body?
    14·2 answers
  • Why onions lost mass when soaked in concentrated solutions of sodium chloride?
    8·1 answer
  • The first person generally credited with fulfilling the functions of the modern director was:
    9·1 answer
  • Is Jamall correct why or why not
    10·1 answer
  • Bacteria with the ability to break down certain types of plastic are places with a colony of E.coli bacteria that lack this abil
    7·2 answers
  • What is the outcome of all chemical changes?
    7·1 answer
  • Fill in the blanks to complete each statement about how mountains affect precipitation.
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!