1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nezavi [6.7K]
1 year ago
5

What is an allele that can have a harmful effect?

Biology
1 answer:
dolphi86 [110]1 year ago
5 0

Answer:

option A is correct i hope you like it

You might be interested in
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
2 years ago
Retroviruses, such as human immunodeficiency virus, rely on reverse transcriptase to multiply inside a cell. However, HIV also r
Serga [27]

Answer:

DNA ⇄ RNA → PROTEINS.

Explanation:

Central dogma explains the flow of genetic information of the living organism. The DNA is converted to RNA by transcription and further into protein product by the process of translation. DNA can increase its number by replication process.

Retroviruses do not follow the central dogma and they have the ability to convert the RNA into the DNA molecule by the enzyme reverse transcriptase. Their central dogma is as follows:

DNA ⇄ RNA → PROTEINS.

Thus, the answer is DNA ⇄ RNA → PROTEINS.

7 0
3 years ago
Two types of cells division which occur in male-female reproduction are reduction division (meiosis) and
o-na [289]

There are two types of cell division: mitosis and meiosis. Most of the time when people refer to “cell division,” they mean mitosis, the process of making new body cells. Meiosis is the type of cell division that creates egg and sperm cells.

  • thus the answer is <u>mitosis</u>

5 0
1 year ago
How many elements in nature are there and what are they
bija089 [108]

Well there's Water, Earth, Fire, and Air. Not quite sure how this would be a school question. But here it is.

8 0
3 years ago
Human embryos have tails, which become tail bones before birth. Tails also appear in fish, reptiles, amphibians, birds, and mamm
lana [24]

Answer: a close evolutionary connection between humans and many other mammals

Explanation:

8 0
1 year ago
Other questions:
  • What happens when a hypothesis is not supported
    11·1 answer
  • What affects the likelihood that an allele will reach fixation in a population that has undergone a bottleneck?
    8·1 answer
  • What is the relationship between an ecosystem and a community
    13·1 answer
  • What is key to preventing extinction of any one species?
    15·1 answer
  • Roger is a 60 year old man who has retired from his job. He is experiencing loneliness and emptiness in his life. What should ro
    12·1 answer
  • Why is it not totally surprising that animals can suffer from emotional distress or mental illness?
    7·1 answer
  • What is the initial source of energy<br> for the entire system?
    11·1 answer
  • During a muscle contraction, the muscle cell membrane becomes temporarily permeable to
    15·1 answer
  • Define the roles of observations and hypothesis in science
    8·2 answers
  • And
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!