1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
SashulF [63]
1 year ago
5

What is the centriality of geography as a science?

Geography
1 answer:
RUDIKE [14]1 year ago
6 0

Geographical centrality is an evolving concept that differs from one perspective to another at different stages. A spatial unit has strong centrality when its average distance to the other spatial units is closer in the region, and such centrality is based on geographical proximity.

Geographic Proximity way the states wherein such business is performed either at the start of the constrained duration or within the future.

They expect that geographical proximity implies high information correlation and nodes which can be toward every other pattern comparable values. as an example, nodes that measure temperature among 10–20° are in all likelihood to be in the direction of nodes that pattern temperature inside 20–30°.

Our foremost assumption is that geographical proximity eases coordination and understanding switch inside collaborations and will increase the possibility of achievement through lowering the expenses of personal contacts, leading to higher communique and know-how change situations, and the introduction of trust (Boschma 2005).

Geographical proximity definition: Geographical or geographic means involved with or regarding geography

The area from which you function will both inspire ability employees to apply to your process vacancies, or it'll discourage them and ship them walking for the hills (i.e. a business enterprise that is located in a miles more appropriate vicinity).

Learn more about Geographical proximity here:-brainly.com/question/24302836

#SPJ1

You might be interested in
What is the Formation of Delta?? HELP!
Mumz [18]

Answer:

A delta is the triangular deposit at the end of a river (where it empties into another body of water). As the river is flowing, it carries sediment and water downstream and deposits it. The delta itself is formed by the sediment building up into a landform.

4 0
2 years ago
The sun's energy moves within the radiative zone via ____.
skelet666 [1.2K]
A: Atoms! Hope this helps ur welcome.
6 0
3 years ago
Read 2 more answers
You are a business man/woman planning a trip to South America to see farm supplies, which 4 countries are you going to be sure t
Greeley [361]

Answer:

chile

Explanation:

its cool

3 0
2 years ago
When a mass increases, its gravitational force
Arisa [49]
Increases. However, put this question is Physics next time
4 0
3 years ago
Read 2 more answers
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
Other questions:
  • What group makes up the largest percentage of Greenland's population? Canadians Danish Inuit Vikings
    7·1 answer
  • Tornados, earthquakes, hurricanes, wildfires, tsunamis are examples of?
    8·1 answer
  • True or false Tycho Brahe showed that the heavens were imperfect and changing
    5·1 answer
  • What are the similarities and differences between the Richter scale and the modified scale​
    10·1 answer
  • What do scientists think produces earth's magnetic field? For 9th grade earth and space science
    7·1 answer
  • Which of the following acts was nicknamed the "Intolerable Acts" by the colonists?
    13·1 answer
  • Lgbtq rights doe <br> true or false?
    14·2 answers
  • One new farming method of planting seeds deep in the ground was called c G r a __________________ ; farmers planted seeds deep i
    9·1 answer
  • Why does the moon have a lower gravitational force than the sun
    8·1 answer
  • The presence of igneous rocks might be evidence of.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!