1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
san4es73 [151]
2 years ago
6

The causative agent for malaria is a type of? a. rickettsial agent. b. protozoa. c. bacterium. d. prion. e. virus.

Biology
1 answer:
irinina [24]2 years ago
3 0

b. protozoa

One of the four species of protozoan in the genus Plasmodium is responsible for the acute or subacute infectious disease known as malaria.

<h3>A virus or a bacteria causes malaria?</h3>
  • A virus or bacteria cannot cause malaria.
  • Plasmodium, a parasite that often spreads through infected mosquitoes, is what causes malaria.
  • A mosquito consumes Plasmodia that are present in blood when it feeds on an infected human.
<h3>How do protozoa cause malaria?</h3>
  • The female anopheles mosquito bite is the primary method of transmission of malaria, a protozoan infection of the red blood cells.
  • The Plasmodium genus of protozoa is what causes malaria.
  • Four different types of malaria parasites can infect people: Plasmodium malariae, vivax, ovale, and falciparum

learn more about malaria here

brainly.com/question/2685790

#SPJ4

You might be interested in
HELP ASAP WILL MARK BRAINLIEST! Idk if my answer is right please help
Svetlanka [38]
I don’t see anything
6 0
3 years ago
Scientists use tools to
marissa [1.9K]

Answer:find basic information and to make of for. Hypothesis or production

Explanation:

6 0
3 years ago
The domestication of animals came before the cultivation of plants in human history
svet-max [94.6K]

Answer:

The first attempts at domestication of animals and plants apparently were made in the Old World during the Mesolithic Period. Dogs were first domesticated in Central Asia by at least 15,000 years ago by people who engaged in hunting and gathering wild edible plants

Explanation:

8 0
3 years ago
Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0
3 years ago
Compare an contrast the terms living and biotic
malfutka [58]
Well living is having life while biotic is pertaining, or produced by life or living organisms. :)
3 0
3 years ago
Other questions:
  • Which methods is utilized by eukaryotes to control their gene expression that is different from the type of control found in bac
    15·1 answer
  • The LEAST LIKELY reason for Cubans to migrate mostly to Miami since the 1960s was the A) American dream. B) better climate. C) p
    9·2 answers
  • For the body to function normally, the organs and tissues must communicate to control the development of the cells and tissues.
    12·1 answer
  • Where does a new plant get the energy it needs to grow when it first germinates?
    12·1 answer
  • The part of the endocrine system that helps the body deal with stress and respond to emergencies is the
    12·1 answer
  • Non-living factors in an ecosystem are
    5·2 answers
  • Select two items that biologists agree are necessary in order to consider an organism “alive.” For each, give an example of a no
    15·1 answer
  • How can fungi reproduce using spores?
    8·2 answers
  • Which key morphological feature is used to classify organisims as mammals?
    15·1 answer
  • Answer ASAP please I only got 10 more min<br><br> Earth &amp; space btw
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!