1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alinara [238K]
3 years ago
11

If women with type o blood and a man with type ab blood have children, what are the childrens possible jeans

Biology
1 answer:
Mila [183]3 years ago
7 0
A woman type O has a child with a man type AB the child could have A, B, AB, or O blood type.  A and B are the dominate alleles but that does not completely rule out O.  Blood type is determined much like eye color. 
You might be interested in
During and experiment what are the factors observed and measured?
Monica [59]
Dependent reaction is the factor that is observed and measured
7 0
3 years ago
In this assignment, you will use simulations to analyze how climate, resources, and habitat size affect
max2010maxim [7]

Answer:

Larger habitats support populations with higher carrying capacities. Higher quality habitats support populations with higher carrying capacities. There is no difference in population growth rate between large and small habitats. Some major threats to biodiversity are: Habitat destruction/Deforestation, Introduced and invasive species, Genetic pollution, Over exploitation, Hybridization, Climate change, Diseases, Human overpopulation. If abiotic or biotic factors change, the carrying capacity changes as well. Natural disasters can destroy resources in an ecosystem. If resources are destroyed, the ecosystem will not be able to support a large population. This causes the carrying capacity to decrease.  

Carrying capacity could be reduced if each individual within the species consumed less from the environment. Think about humans: if every human needs a four car garage and a large house, the planet can sustain fewer humans than if each human lived in a studio apartment and traveled using a bicycle. It would take 1.75 Earths to sustain our current population. If current trends continue, we will reach 3 Earths by the year 2050. It is beyond dispute that the modern industrial world has been able to temporarily expand Earth's carrying capacity for our species. As Nordhaus points out, population has grown dramatically (from less than a billion in 1800 to 7.6 billion today), and so has per capita consumption. Historically, habitat and land use change have had the biggest impact on biodiversity in all ecosystems, but climate change and pollution are projected to increasingly affect all aspects of biodiversity. Sustainable agriculture practices support integrating biodiversity in various ways including in terms of diversity of crops, traditional agriculture techniques to control pests and increase productivity as well as ensuring that farmed land is made up of a diverse mix of grazing land, crop land, orchards, wetlands and more.

Explanation:

Hope this helps :)

5 0
3 years ago
PLEASE, SOMEONE HELP ME! :) When we think about the effects of air pollutants we immediately think of respiratory issues. Exposu
SVETLANKA909090 [29]
Working down mate, my best answer would be carbon monoxide, but I'm not studying exactly what you are.  All those answers are logical except ozone.
8 0
3 years ago
What is the most important role that water plays for living organisms?
Ksivusya [100]
All organisms need water to transport chemicals into their cells
5 0
3 years ago
Read 2 more answers
Which of the following would be an
OLga [1]

Answer:

None of these options is correct.

Explanation:

As in first option animal show herbivorous behaviour by eatin plant as well as in second option  plant is toxic for animal .

while symbiosis is a process in which two animals stay together to harm each other or to help each other or for some other conditions but in these options there is no such situation here.

6 0
3 years ago
Other questions:
  • Hi plz help!!!!! Please
    13·1 answer
  • White eye color is an x-linked trait in one line of fruit flies. white eyes is recessive to red eyes. if a red-eyed female and a
    8·1 answer
  • Look at the jellyfish in figure 25-6. How many planes of symmetry could you draw through this animal?
    15·1 answer
  • I REALLY NEED I JUST HAVE TO DO TWO MORE STUFF TO FINISH SCIENCE BUT I STILL NEED TO ALGEBRA I HAVE UNTIL FRIDAY TO FINISH SCIEN
    13·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • it requires 12 hours to fill 3/5 of a swimming pool at this rate how many hours is required to fill the remainder pool
    11·1 answer
  • Seven cups of instant coffee contain 315 mg of caffeine.
    13·2 answers
  • Dhjwbsjsbsdjiwjwiwkeiw
    10·2 answers
  • What does a phylogenetic tree represent?
    9·2 answers
  • Brainly Est question
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!