1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bazaltina [42]
2 years ago
12

The cells of a mature pea plant have 14 chromosomes. how many chromosomes does a nucleus in the pea endosperm contain?

Biology
1 answer:
DIA [1.3K]2 years ago
5 0

If pea plant cells contain 14 chromosomes, a pea plant's gamete cell contains 7 chromosomes.

<h3>Describe chromosomes.</h3>

Chromosomes are a pair of thread-like structures that are found in cells.

Re genes and a person's personality are found on the chromosomes.

Meiosis causes the daughter cells to contain half of each chromosome.

<h3>What does a chromosome do primarily?</h3>

Chromosomes' primary role is to transport DNA, which is the building block of all genetic material. DNA contains the genetic instructions for a number of cellular processes. These activities are necessary for the organisms' development, maintenance, and procreation. Chromosomes are shielded by proteins like histones.

To know more about Chromosomes visit:

brainly.com/question/1596925

#SPJ4

You might be interested in
Always return the
Nady [450]

Answer:

When you are finished with the microscope, return the scanning lens (4X) to place.

Explanation:

8 0
2 years ago
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​
pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
3 0
3 years ago
What are three examples of matter besides water that are transported through ocean currents
ololo11 [35]
Matter is anything that has mass. everything has matter, even the air.
7 0
3 years ago
In early pregnancy, what hormone stimulates growth of the corpus luteum? human chorionic gonadotropin follicle-stimulating hormo
disa [49]
Human chorionic gonadotropin (hCG) is secrete by the embryo early in pregnancy to keep the corpus luteum for dying. This positive feedback will maintain the corpus luteum, which secretes Progesterone and Estrogens throughout pregnancy, in order to keep the endometrium well to nourish the embryo/fetus.
6 0
3 years ago
What you observe when examining the onion root tip using the low-power lens
bezimeni [28]

Explanation:

Low power objective shows more field of view but does not give appreciable details about the view.

  • In the root tip of onions, the cell walls are distinctly visible and they are arranged in a rectangular mosaic pattern.
  • The nucleus stands out appreciably and it is tiny.
  • The cytoplasm is also visible.
  • Root cells do not have chloroplast since they do not take part in photosynthesis.

Learn more:

Onion cell brainly.com/question/2855039

#learnwithBrainly

4 0
3 years ago
Other questions:
  • Why are digestive enzymes in cell enclosed in a membrane-bound organelle
    10·1 answer
  • Which element is found in proteins and nucleic acids but not in carbohydrates
    7·1 answer
  • Jennifer regularly instructs her students to avoid believing age-old theories about the differences between men and women. "As i
    6·1 answer
  • Which statement describes a newton?
    13·1 answer
  • The complicated molecules that make up living things usually contain carbon. Why is carbon so important in this molescules?
    5·2 answers
  • In a large firm, what can a functional structure foster, even though it can be counter-productive to the goals of the organizati
    6·1 answer
  • Permafrost (gelisol) is considered a hearty, robust soil type. Please select the best answer from the choices provided T F
    15·1 answer
  • Except for identical twins, all the other human beings are genetically distinct from each other. Why is this true?
    15·2 answers
  • Types of passive transport
    8·1 answer
  • Using energy from a vehicle to recharge the battery when slowing down or stopping the vehicle is called what?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!