Hunting IS NOT a form of artificial selection because it is not a form of breeding. Artificial selection refers to the intentional breeding of plants or animals. An example would be a thoroughbred racehorses, because they were selectively bred.
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
A small rocky body orbiting the sun
No i don't think so; this is because in a particular energy pyramid, no additional energy enters the system, and energy is lost to the environment at energy level. An energy pyramid is the pyramid that shows the availability of energy that connects the consumers with the decomposers shows the energy transfer between trophic levels. It shows that less and less food and energy is available as you go from the base to the top of the pyramid.
Answer:
C is not true, biotic compounds do in fact need abiotic factors.
