1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
MrRissso [65]
1 year ago
10

The enzyme that travels along the leading strand assembling new nucleotides on a growing new strand of dna is?

Biology
1 answer:
ICE Princess25 [194]1 year ago
7 0

Polymerase is the enzyme that moves along the leading strand of a growing new strand of DNA to assemble new nucleotides.

<h3>Describe an enzyme:</h3>

A material created by a living thing that functions as a catalyst to trigger a certain biological reaction.

<h3>Enzyme example: </h3>

Amylase: Amylase aids in the conversion of carbohydrates to sugars in the saliva. The salivary enzyme maltose breaks down the sugar maltose into glucose. Trypsin In the small intestine, these enzymes convert proteins into amino acids.

<h3>Enzyme: A protein or not?</h3>

Enzyme-like proteins are composed of amino acids linked by one or more polypeptide chains. This configuration of amino acids is referred to as the basic structure of a polypeptide chain.

To know more about Enzyme visit:

brainly.com/question/14953274

#SPJ4

You might be interested in
PLEASE help me i am stuck In pea plants the allele for round seeds (R) is dominant and the allele for wrinkled seeds (r) is rece
erastovalidia [21]

Answer:

I am positive it is C your welcome :)

7 0
3 years ago
Read 2 more answers
Oceans play an important role in determining climate change. Ocean circulation affects the climate through the atmospheric conce
Greeley [361]

the answer is carbon dioxide

3 0
3 years ago
The purpose of transcription is to create
Levart [38]

Answer:

B. a sequence of DNA bases that duplicates a sequence of RNA bases.

Explanation:

Transcription is the first step in gene expression. It involves copying a gene's DNA sequence to make an RNA molecule.

4 0
3 years ago
PLEASE HELP:
arlik [135]

Answer:

Cells can generate from nonliving matter,

Explanation:

He concluded that only living cells can produce cells/ only life can produce life. so if the fact that cells can generate from matter that is not living, it would disprove his theory because his theory was that only living things can produce living things.

6 0
3 years ago
Which characteristic of a pine tree is an adaptation to the climate of the northwestern coniferous forests? Deep roots Conical s
Travka [436]
I’d say conical shape- coniferous trees are known for this shape.
6 0
3 years ago
Read 2 more answers
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • What is the probability of producing a tall pea plant from cross between two hybrid tall pea plant?
    14·1 answer
  • What is a mountain life zone
    13·1 answer
  • Fires help some forest communities by allowing some trees to release their seeds, by clearing away dead wood, and by encouraging
    10·1 answer
  • Which of the answer correctly explains how the ATP molecule differs in function from the ADP molecule?
    15·2 answers
  • Chromoplasts, which store starch, are most abundant in roots and tubers
    10·1 answer
  • Skin color fur color and height are examples of which inheritance pattern ?
    14·2 answers
  • What are the 2 main categories of cells?
    6·2 answers
  • Hooke made scientific advancements that revolutionized our understanding of the basic building blocks of life.
    14·1 answer
  • What is the arrangement of oxygen molecules in a liquid state
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!