1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kari74 [83]
3 years ago
9

How does atp provide the energy cells need

Biology
1 answer:
insens350 [35]3 years ago
5 0

Answer:

Adenosine triphosphate (ATP), energy-carrying molecule found in the cells of all living things. ATP captures chemical energy obtained from the breakdown of food molecules and releases it to fuel other cellular processes.In a process called cellular respiration, chemical energy in food is converted into chemical energy that the cell can use, and stores it in molecules of ATP. When the cell needs energy to do work, ATP loses its 3rd phosphate group, releasing energy stored in the bond that the cell can use to do work.

You might be interested in
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Which of the following choices correctly describes the composition of the cell membrane
lukranit [14]
I would say the second one

3 0
3 years ago
Read 2 more answers
30 POINTS
Anika [276]
The answer is 9 because to find the amount of neutrons you have to take away the atomic number from the mass
7 0
3 years ago
Once Telophase is complete, the cell has become two identical
ra1l [238]
The answer is to the problem is false
8 0
3 years ago
What function and location of igd and igm​
SIZIF [17.4K]

idgis primarily found on the surface of B lymphocytes where it functions as a receptor for antigen.

img antibodies are found in blood and lymph fluid and are the first type of antibody made in response to an infection. They also cause other immune system cells to destroy foreign substances.

6 0
2 years ago
Other questions:
  • Hoxc8 genes are responsible for the development of what
    7·1 answer
  • Blood has traveled from the heart to the toes. Which describes the next step
    5·1 answer
  • Tomato plants usually have hairy stems. Hairless stems are present in tomato plants that are homozygous recessive for this trait
    6·1 answer
  • WILL GIVE BRAINIEST!!!!!
    14·1 answer
  • The quality of services depends on who provides them as well as when, where, and how they are provided. Which characteristic of
    7·1 answer
  • Which of these statements refers to convection?
    13·2 answers
  • Peter has just had surgery and is on nasogastric suction. this involves removing fluids from the stomach through a tube. the new
    5·1 answer
  • What does the abbreviation "daL" stand for?​
    12·1 answer
  • *<br> What are genes?<br> O carbohydrates<br> O coded messages<br> O proteins<br> O lipids
    7·2 answers
  • What is evolution?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!