Answer: Bacteria lack a mechanism for splicing out introns
Explanation:
Factor VII gene is 186k nucleotides long while the protein is 2332 amino acids long. <u>This lenght discrepancy is due to introns interrupting gene</u>, because the cell first transcribes the entire gene and then cuts introns out of the transcript. At the end, it splices the remaining pieces. Prokaryotes don't perform splicing so it can not edit out introns from the primary mRNA transcript. To produce an eukaryote gene in prokaryotes it is necessary to use a reverse transcriptase to get a cDNA sequence without the introns, and then insert that into a bacterial genome.
The mass of a tree is primarily carbon. The carbon comes from carbon dioxide used during photosynthesis. During photosynthesis, plants convert the sun's energy into chemical energy which is captured within the bonds of carbon molecules built from atmospheric carbon dioxide and water.
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.
Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT
These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
Enzymes speed up all of the reactions that happen inside cells. They help with digestion and our metabolism. Enzymes can do a few different things like:
Break up big molecules into smaller pieces, so they can be absorbed more easily by the body.
Enzymes also are very picky catalysts, and will only “speed up” certain types of reactions.
Hope this helps you!! (:
I believe the thyroid controls most, if not all of those things. (Again, I'm not entirely sure.)
