1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anit [1.1K]
1 year ago
12

Which group, named from their cuplike sexual reproductive asocarp, make up 75% of know fungi?

Biology
1 answer:
Marina CMI [18]1 year ago
5 0

Answer: Sac Fungi, or Ascomycota.

Explanation: This type of fungi has cupcake asocarp.

You might be interested in
When a doctor observes your symptoms and tells you that you have flu, she is reasoning?
Hoochie [10]

When a doctor observes the symptom of a patient and tells that he or she is likely having a flu, the reasoning she or he used is likely from the effect to cause. The reasoning from effect to cause is having to check on the cause in order to produce or come out with the effect in which the symptoms is the cause of the flu, in which the flu is the effect.

6 0
3 years ago
What is SI and what number is it based on?​
Tatiana [17]

Answer:

SI is an abbreviation for "Système Internationale", also know as the metric system. It's based on units of 10.

4 0
3 years ago
What type of carbon cycling occurs when plants take in carbon dioxide from the atmosphere to make food and plants, and animals r
liberstina [14]

Answer:

short-term carbon cycling

Explanation:

my answer points to the idea that it takes a shorter amount of time for the process to occur

7 0
3 years ago
What two measurements does a GPS device use to find a specific location? How many satellites does a
Anna [14]

Answer:

Four satellites are needed to find your location. GPS's get the signal from satellites and that can calculate the distance you are from those satellites and location. the satellites emit high frequency low power signals that your GPS can pick up.

Explanation:

4 0
3 years ago
Why do researchers believe that mammals evolved such large brains, such as that of hadrocodium?
tresset_1 [31]

Cause mammals are the only species that are well developed before birth unlike marsupial and monotremes

5 0
4 years ago
Other questions:
  • What is it called when bacteria take in DNA from their environment?
    11·2 answers
  • Which of the following is a need of most plants? A. To release carbon dioxide to the environment. B. To take up oxygen from the
    8·1 answer
  • Which environmental conditions are most favorable for hurricane formation?
    15·1 answer
  • Insulin is synthesized and released by the: brain. liver. pancreas. gallbladder.
    13·1 answer
  • Explain why a hydrogen atom can become either an ion or part of a molecule
    14·1 answer
  • How many full-length strands of hair are collected from the scalp to use as a sample?
    8·2 answers
  • Homologous structures are those that:
    6·2 answers
  • Male Australian bowerbirds build and decorate elaborate structures, called bowers, out of grasses and other vegetation. If we wa
    5·1 answer
  • what are large chemical compounds, primarily consisting of carbon and hydrogen, that exist in living organisms.
    14·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!