1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
krek1111 [17]
3 years ago
14

Which statement best defines the relationship between work and energy?

Biology
2 answers:
Free_Kalibri [48]3 years ago
7 0

Answer:

The answer is...

B) Work can transfer energy between objects and cause a change in the form of energy.

Explanation:

I got it right on my test 100%.

Edge 2021

Semmy [17]3 years ago
6 0

Answer:

Work can transfer energy between objects and cause a change in the form of energy.

You might be interested in
Which organs produces hormones under the influence of the pituitary gland
mrs_skeptik [129]

Answer:

hypothalamus

Explanation:

I hope this helps

5 0
3 years ago
Vertical ocean circulation is generated by
icang [17]

Answer:

B. maybe I dont know but can you help me with dna

5 0
3 years ago
Where are the macromolecules found in the body
nata0808 [166]

Answer:

There are four major classes of biological macromolecules.1.)carbohydrates 2.)lipids 3.)proteins 4.)nuclic acids .each is an important cell component a performs a wide array of functions.

5 0
3 years ago
Which best describes what is happening in the area marked y
Zigmanuir [339]

Answer:

Oxygen is being released through the Stomata

Option (A)

4 0
3 years ago
Read 2 more answers
Which statement about the changes in the history of life on Earth is correct? A. The theory of plate tectonics explains why the
otez555 [7]

Answer:

C

Explanation:

6 0
4 years ago
Other questions:
  • Which of the following statements is FALSE? A. Class 1 MHC molecules are built into the plasma membranes of all body cells. B. C
    9·1 answer
  • According to the Shannon Diversity Index, which of the five blocks above, with each containing 36 squares, would show the greate
    15·1 answer
  • What makes up the "code" of DNA?
    5·2 answers
  • Mammalian eyes sense light because the photoreceptor cells have molecules called opsins, which change structure when exposed to
    9·1 answer
  • create a scientific argument of one to two paragraphs that support or oppose the current flu vaccine recommendations.
    14·2 answers
  • Did the T. Rex have an amniotic egg?
    6·1 answer
  • How to reduce pimples ?​
    12·2 answers
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
  • The taiga biome has long, cold, dry winters and cool, wet summers. In three to four sentences, describe how the plants and anima
    13·1 answer
  • A population is in Hardy-Weinberg equilibrium at a locus with two alleles, A and a, each with a frequency of 0.5. A is completel
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!