1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
shusha [124]
2 years ago
10

Areas along the costal regions of continents have more moderate climates than their inland counterparts. What property of water

allows this to be possible?
Biology
1 answer:
Nadusha1986 [10]2 years ago
7 0

Areas along costal regions of continents have more moderate climates than their inland counterparts because Water has a high specific heat.

Water has a higher heat capacity than soil and rock, so the ocean takes much longer to heat and to cool than the land. Coastal areas will generally have more moderate temperatures than inland areas because of the heat capacity of the ocean.

Large bodies of water such as oceans, seas, and large lakes affect the climate of an area. Water heats and cools more slowly than land. Therefore, in the summer, the coastal regions will stay cooler and in winter warmer. A more moderate climate with a smaller temperature range is created.

To learn more about Water , here

brainly.com/question/19920929

#SPJ4

You might be interested in
░░░░░░░░░░░░░░░░░░░░░▄▀░░▌
Sati [7]

Answer:

It helps heal a bruise by producing the energy required to heal cells.

Explanation:

The mitochondria, which are responsible for cellular respiration, are also the powerhouses of the cells, and create the energy the cell uses.

6 0
3 years ago
Read 2 more answers
Adenylyl cyclase has the opposite effect of which of the following?
sladkih [1.3K]
The answer is c. phosphodiesterase
7 0
3 years ago
Identify the specific process by which the clavicle develops.
o-na [289]

Answer:

The clavicles and the cranial bones of the skull develop from a fibrous membrane. This process is known as intramembranous ossification.

7 0
4 years ago
I need help on this question
ryzh [129]
I think the answer is B. I’m not completely sure
4 0
3 years ago
Read 2 more answers
A nerve poison that blocked neurotransmitter receptors on the dendrites would __________.
lawyer [7]
<span>Answer: prevent transmission across the synaptic cleft

When the poison binds to the </span>neurotransmitter receptors <span>on the dendrites, it will block the receptors. The neurotransmitter cannot bind to the blocked receptors, making it unable to work. The poison should cause paralyzing effect because the signal cannot be sent. 
One of the toxins that work this way is curare.</span>
3 0
3 years ago
Other questions:
  • A cold-tolerant and salt-tolerant organism would likely be found in which part of the ocean..A)Transition zoneB)Deep zoneC)Polar
    13·2 answers
  • A North Carolina timber company proposes to clear-cut 45 hectares of oak-hickory deciduous forest in the Appalachian Mountains.
    14·1 answer
  • What step first happens in DNA replication?
    11·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has
    15·1 answer
  • Which pair of scientists put their ideas together to create the initial Cell Theory?
    7·2 answers
  • Assume that all possible “ABO” blood phenotypes are present in a human population that is in Hardy-Weinberg equilibrium. If the
    8·1 answer
  • You are at soccer practice on a hot day. After practice a teammate accepts a challenge to drink four gallons of water as fast as
    8·2 answers
  • Which one is it? help please
    13·1 answer
  • State disorders in human beings that result from chromosomal mutation?​
    9·1 answer
  • which type of amino acid would you expect to find in large numbers in a protein found in a deep-sea hydrothermal vent (a very ho
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!