1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Arlecino [84]
1 year ago
8

Blood carries oxygen from your lungs to the rest of your body. As you inhale, high oxygen concentration is taken up by your lung

s. The lungs have a higher oxygen concentration than the blood. Oxygen will diffuse out of the lungs and into your blood.
Is this Passive or Active Transport?
Biology
1 answer:
madam [21]1 year ago
8 0
Diffusion is a passive process. Passive transport
You might be interested in
The ________ plate method involves spreading an inoculum onto the surface of a plate in a pattern that results in isolated colon
asambeis [7]

Answer:

Streak, pour.

3 0
3 years ago
Identify the indentation that is inferiorolateral to the auricular surface. Identify the indentation that is inferiorolateral to
gizmo_the_mogwai [7]

Answer:

The correct answer is - Greater sciatic notch

Explanation:

The greater sciatic notch is a notch in one of the pelvic bones n the human called the ilium. It is located between the posterior inferior iliac spine, and the auricular surface or ischial spine. It is the passageway through the pelvis into the thigh and posterior side.

3 0
3 years ago
Most genes have a dominant and recessive version called an
olchik [2.2K]

Answer:

They are called alleles.

Explanation:

Different versions of a gene are called alleles. Alleles are described as either dominant or recessive depending on their associated traits.

3 0
3 years ago
If the pride is taken over by new individuals what happens to the female ?
Step2247 [10]

Explanation:

Pride is the social community of lions where they grow, mate, reproduce, communicate, hunt etc. When male lions gets control of a new territory or a pride, they most of the times kill the cubs of the pride because they are not biologically related and do not want to waste their energy by ensuring that the cubs genes are passed on.

They don't want to be stepfathers. Female lions also will not be responsive to mating during the time they are feeding, so killing the cubs allows the male lions to reproduce.

3 0
3 years ago
Read 2 more answers
When computer mapmakers digitize map data, they __________.
vivado [14]
Find latitude and longitude
4 0
3 years ago
Read 2 more answers
Other questions:
  • How is breathing related to the process of retrieving energy from food molecules
    12·1 answer
  • The metaphyses of a 40-year-old's long bones have?
    10·1 answer
  • Describe the effects that enzymes can have on substrates amoeba sisters
    15·1 answer
  • What is the measure of an inscribed angle with an arc angle measure of 120°
    5·1 answer
  • If a spear is thrown at a fish swimming in a lake, it will often miss the fish completely. Why does this happen?
    13·1 answer
  • An individual that is homozygous dominant for type B blood and little finger shape mates with an individual that is heterozygous
    9·1 answer
  • Humans and animals often live together share the same resources without conflict live without affecting each other compete for l
    10·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Why Is It Important To Avoid Applying Too Much Nitrogen Fertilizer?
    11·2 answers
  • How do we ensure that society appreciates the full importance of plants?​
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!