1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Serhud [2]
1 year ago
6

If the density of ethanol is 0.789 g/mL, how many milliliters are produced in this reaction?

Biology
1 answer:
yarga [219]1 year ago
7 0

The volume of the ethanol is 6.7 mL

<h3>What is the density of the ethanol?</h3>

We know that density is defined as the ratio of the mass to the volume of an object. We know that the density is said to be an intrinsic property and this means that we can use the density of the object to be able to obtain the kind of object that we are dealing with.

We have the information that the mass of the carbon dioxide that can be obtained from the reaction is about 10 g. We can now use this to obtain the number of moles by the use of the formula;

Number of moles = mass/ molar mass

= 10 g/44 g/mol

= 0.23 moles

From the reaction equation:

1 mole of ethanol produces 2 moles of carbon dioxide

x moles of ethanol produces 0.23 moles of carbon dioxide

x = 0.23 × 1 /2

= 0.115 moles

Mass of ethanol = 0.115 moles × 46 g/mol

= 5.29 g

Volume of the ethanol = mass/density

volume = 5.29 g/0.789 g/mL

= 6.7 mL

Learn more about ethanol;brainly.com/question/250024

#SPJ1

You might be interested in
If _________ accumulates around the teeth over a period of time, periodontal disease may result.​
Semmy [17]

Answer:

If <u>bacterial plague</u> (a.k.a. dental plague) accumulates around the teeth over a period of time, periodontal disease may result.

6 0
3 years ago
How were American farmers in the 1940s impacted by new technology? a. They were able to increase their productivity due to the p
MrMuchimi

Correct Answer is A. They were able to increase their productivity due to the popularity of tractors.

7 0
3 years ago
How do scientists obtain knowledge about the world?
Sphinxa [80]
Well, scientists depend on science.They use the process of observation. But there are processes for these. The processes are;
Asking a question; Scientists wonder how specific happenings can be explained, they look for an answer.
They perform research; the scientists study the  particular thing, and look for reasons for a particular happening.
They form a hypothesis; a hypothesis is a statement which is not universally true, they are observations that haven't been agreed upon.
They test their hypothesis; they perform experiments to find out if their hypothesis is true.
They analyse the data and draw a conclusion; they record their hypothesis and write down their end result.
They pass across their result; they pass their new observation across to other people.
    Hope i helped. Have a nice day. 
7 0
3 years ago
Read 2 more answers
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
What are perlemoen used for?​
r-ruslan [8.4K]

Answer:

We use them for the meat as food and the shells as decorative items

Explanation:

hope this helps

3 0
2 years ago
Other questions:
  • How did pasteur help fighting infectious diseases
    13·2 answers
  • Which portion of the cerebral cortex is most closely adjacent to the ears?
    14·1 answer
  • While taking a walk in a park, Muskaan observed an insect on a pitcher plant (Nepenthes). Immediately the flower opened up and t
    14·1 answer
  • How does a dog meet all the characteristics of life
    14·1 answer
  • Diastole is the ________ phase of the cardiac cycle.
    5·1 answer
  • PLEASE HELP
    11·1 answer
  • I’m very smart. My hair is dark. I love to eat honey, insects, and bark. What am I (10 letter word)
    5·2 answers
  • What is oxygen debt​
    11·1 answer
  • Help? It’s ok if not but I really need it &lt;333
    15·1 answer
  • ____________ is often criticized by both heterosexuals and lesbian/gay individuals as indicating promiscuity, indecisiveness, or
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!