1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
deff fn [24]
1 year ago
7

50 POINTS Read and answer the question below PICTURE ATTACHED

Law
1 answer:
Ket [755]1 year ago
5 0

Answer: The Third Answer

Explanation: He stated that the Government the Framers created was flawed, but not that it was unfixable or that it is still that way so it must be the 3rd answer. The first two answers are completely the opposite of the text.

You might be interested in
Why is it that any law which contradicts natural law is unjust?
IceJOKER [234]
There is one called predicción
8 0
2 years ago
What is a legal word meaning to administer punishment for violations
poizon [28]
A fine or go to jail
4 0
3 years ago
F R E E. P O I N T S !​
Temka [501]

Answer:

sfhrhvfhfthtynftngtjvgyhtgvg

3 0
2 years ago
Read 2 more answers
PowerPoint on investigation on a crime scene.
Harman [31]

Answer:

Explanation:

Complete the presentation and extra work themselves; in the future, the individual will have to remember to send everything or risk doing the extra work themselves.  

Explanation:

Not only this helps in increasing accountability in the individual but it would also help in influencing the behavior of the individual in the future. He would be more responsible for delegating the tasks as he would learn from his mistakes. This would go a long way in developing a competent and responsible workforce which would help in increasing the effecency of the company.

3 0
2 years ago
Explain the reasons and challenges our society is facing in order to have a high percentage of adolescence and young adult commi
musickatia [10]

Answer:

thanks for the points btw its b

Explanation:

8 0
3 years ago
Read 2 more answers
Other questions:
  • The emphasis on rehabilitation in our criminal justice system has produced substantially lower rates of recidivism. T or F.
    10·1 answer
  • Sonoma County passed a law making it legal to drive 65 mph on freeways inside the county, A state law limited all vehicles anywh
    6·1 answer
  • hen parents divorce and move to separate residences the parents who live in the same household as the children referred as the -
    7·1 answer
  • 00
    11·1 answer
  • PLEASE HELP ASAP!!! GO TO OTHER QUESTIONS TOO!! Committing a hit-and-run in the state of Florida can lead to
    14·2 answers
  • How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT
    15·1 answer
  • The rate of alcohol absorption is the same for everyone.<br> A. True<br> B. False
    6·2 answers
  • Do you agree that incarceration is a better method of correction than corporal punishment?
    11·2 answers
  • Which of the following statements is true about a "failure to act?"a.It can be a crime to do nothing in some situations.b.The mo
    6·1 answer
  • Which federal agency regulates the transportation of regulated product within the united states.
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!