1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
telo118 [61]
1 year ago
5

differences in the beak depth (in the figure below) of the three species of geospiza (darwin's finches) that are found on the ga

lapagos islands of pinta and marchena suggest that:
Biology
1 answer:
worty [1.4K]1 year ago
6 0

As described in this case, firstly G.fuliginosa species of bird were live on Los hermanos island solely thus they didn't face any competition.

Darwin's finches are a group of birds that diversified after they migrated from South America to the Galapagos Islands. They each evolved on separate islands separated by large bodies of water. They are therefore an example of allopatric speciation. Repeated volcanic eruptions have helped shape the rugged mountainous landscape of the Galapagos Islands.

The Galapagos Islands are known for their diversity of flora and fauna. Many species are endemic and cannot be found anywhere else in the world. The Galapagos Islands lie on either side of the equator in both the northern and southern hemispheres. These islands are located at the confluence of her three currents in the Pacific Ocean creating an area where warm and cold waters converge.

Learn more about The Galapagos Islands here:-brainly.com/question/303869

#SPJ4

You might be interested in
What is 23 the three is suppose too be small
Hunter-Best [27]

Answer:

i donttt no no no. noojbhj

6 0
2 years ago
Read 2 more answers
Which details in this contemporary story were likely influenced by the story of Theseus and the Minotaur?
Lyrx [107]

Answer:

holding a yearly drawing

using the color black to indicate the unlucky winner

sacrificing people from the town every year

5 0
3 years ago
Chemical weathering is the breakdown of rocks, soils, and minerals through _______.
Anvisha [2.4K]

Answer: The answer would be A.

Explenation:

<em>Chemical weathering is the breakdown of rocks, soils, and minerals through atmospheric or biologically produced chemicals.</em>

4 0
3 years ago
Which of the following does not contribute to the formation of the Mid-
zhuklara [117]
The answer to your question is A.
8 0
2 years ago
If a person didn’t have red cones, how would their perception of color change?
loris [4]

Answer:

They would be color blind.

Explanation:

For example, if the red cone is missing you will be unable to see colors containing red as clearly. There are several different types of color blindness. Dichromatism is when one of the cones is missing.

4 0
3 years ago
Read 2 more answers
Other questions:
  • Which option identifies one section of the ocean floor?
    14·2 answers
  • Elements can be broken down through what processes
    9·1 answer
  • What are the base pairs in DNA and RNA?
    6·2 answers
  • In nature, organisms mate without human interference. This is called
    6·1 answer
  • Choose only one correct option. Explanation needed.
    7·2 answers
  • Why would cells die if they were unable to make (or otherwise obtain) the amino acid arginine?
    10·1 answer
  • The volume of Uranius is less than 1/10 of the volume of Saturn
    11·1 answer
  • Help no links or you'll be reported
    15·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Help me please
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!