1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
siniylev [52]
1 year ago
6

An individual having two different alleles of a specific gene is described as being _________ for that specific trait.

Biology
1 answer:
borishaifa [10]1 year ago
5 0

An individual having two different alleles of a specific gene is described as being Heterozygous for that specific trait.

You have a heterozygous genotype for that gene if the two versions differ. Being heterozygous for hair color, for example, means you have one allele for red hair and one allele for brown hair. The interaction of the two alleles influences which traits are expressed.

Being homozygous for a gene means you inherited two identical copies. It is the inverse of a heterozygous genotype, in which the alleles differ. People with recessive characteristics, such as blue eyes or red hair, are always homozygous for that gene. In genetics, heterozygous means having inherited different versions (alleles) of a genomic marker from each biological parent. As a result, a person who is heterozygous for a genomic marker has two distinct versions of that marker.

To learn more about Heterozygous, here

brainly.com/question/451365

#SPJ4

You might be interested in
A child is brought to the emergency department struggling to breathe with a prolonged bronchospasm and severe hypoxemia. Assessm
drek231 [11]
Pulmonary embolism because it’s unlikely to have a high heart rate with others
4 0
3 years ago
What is An example of dehydration synthesis
nekit [7.7K]
Dehydration synthesis<span> is the process of joining two molecules, or compounds, together following the removal of water. When you see the word </span>dehydration<span>, the first thing that may come to mind is 'losing water' or 'lacking water.' ... </span>Dehydration synthesis<span> is classified as a type of chemical reaction.</span>
3 0
3 years ago
To avoid credit problems, follow your
expeople1 [14]

Answer: credit score or pay off your bills on time.

Explanation:

7 0
2 years ago
Read 2 more answers
Which statement about plants cells is MOST accurate? A) Plant cells take in nutrients by phagocytosis. B) Plant cells do not nee
MrRissso [65]
The answer is 1000% D) Plant cells, take in small molecules through the cell membrane

7 0
3 years ago
Read 2 more answers
Eukaryotic cells are differentiated from prokaryotic cells because eukaryotic cells: Have a higher rate of reproduction. Have pe
maksim [4K]
Eukaryotic cells have a nucleus and Prokaryotic cells do not.
4 0
3 years ago
Read 2 more answers
Other questions:
  • Two plants are crossed, resulting in offspring with a 3:1 ratio for a particular trait. what does this suggest?
    7·1 answer
  • What happens when a environment changes​
    6·1 answer
  • Explain the difference between how animals and plants form their organs?
    12·1 answer
  • How much water are we pumping out of the ground using wells in the US alone?
    14·2 answers
  • What natural methods remove co2 from the atmosphere ?
    9·1 answer
  • How have engineers designed spacecraft to operatein the special conditions of space?
    11·1 answer
  • Jerome is performing an experiment for the science fair. He wants to know how long it takes for water to evaporate at varying te
    5·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • I need help this is for sociology <br> Which term is used to describe a two-person group
    9·1 answer
  • What are two primary factors that sometimes cause the Colorado River to run completely dry before reaching the Gulf of Californi
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!