1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vladimir79 [104]
1 year ago
15

Once starch in a person's diet has been broken down into _____, those subunits are absorbed in the small intestines.

Biology
1 answer:
Murrr4er [49]1 year ago
6 0

Once starch in a person's diet has been broken down into monosaccharides those subunits are absorbed in the small intestines

Carbohydrates, also referred to as sugars, are a type of polymer. They are polymers whose subunits are linked together by glycosidic linkages that, when water is released, form a bond between two monomeric units. The amount of monomers that must come together to make a carbohydrate allows for the division of the carbohydrates into various groups. The monosaccharide, commonly known as simple sugars, is the most basic type of carbohydrate chain.

Since they exist as a single unit and are not connected to any other monosaccharides, these molecules are frequently referred to as the monomers of a carbohydrate chain.

To learn more about monosaccharides refer the link:

brainly.com/question/14308313

#SPJ4

You might be interested in
Why do plants need water?​
ANTONII [103]

Explanation:

plants need water for the process of photosynthesis and transpiration

6 0
2 years ago
Read 2 more answers
Why do we add gel loading buffer at the end of the digestion
tiny-mole [99]

Answer:

dunno

Explanation:

3 0
2 years ago
Describe how epinephrine has different effects in different target tissues
vazorg [7]

Answer:

Epinephrine binds to receptors on some smooth muscles (ex: around arterioles) → Ca++ released from ER → intracellular Ca++ up → stimulates contraction. c. Epinephrine binds to receptors on some smooth muscles (ex: around bronchioles) → phosphorylates protein needed for response to Ca++, preventing response.

4 0
3 years ago
The United States uses about _____ of the oil produced in the world.
Tresset [83]
Well the U.S. consumes about 7.19 Billion barrels of petroleum related products in 2016.

The U.S. currently uses roughly 25% of all of the world's global reserves.
Hey, America likes oil, leave them alone


7 0
3 years ago
Match each of the leg muscles with the correct label.
g100num [7]

Answer:

For the Numbers on the leg Photo

1. Rectus Femoris

2. Vastus lateralis

3. Tibialis Anterior

4. ADDuctor longus

5. Gracilis

6. Satorius

7. Vastus Medialis

8. Gluteus Medius

9. Gluteus Maximus

10. Semitendinosis

11. Semimembranosus

12. Biceps Femoris

13. Gastrocnemius  

Explanation: is correct

4 0
2 years ago
Other questions:
  • Most of the digestion that takes place in the small intestine occurs in the __________.
    9·1 answer
  • Ribs that are not attached to the sternum at their anterior costal cartilages are known as1.vertebrochondral ribs2.vertebrostern
    5·1 answer
  • Which of the following explains why children must be vaccinated for communicable diseases, like measles?
    10·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • The specific heat of iron is 0.11 cal (g°C) . A cafeteria fork made of iron has a mass of 20 grams. How much heat energy is need
    9·2 answers
  • Help pleaseeeeeeellllll
    13·1 answer
  • What is the hottest water a person can stand?
    12·1 answer
  • In humans, XO individuals are females with Turner syndrome and XXY individuals are males with Klinefelter syndrome. Red green co
    5·1 answer
  • Please please help hdjdjd question 9
    12·1 answer
  • Fossils of the same plants and animal species have been
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!