1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Aliun [14]
4 years ago
8

Can someone help me out with this one?

Biology
1 answer:
o-na [289]4 years ago
4 0

The answer is B) Convection

You might be interested in
I need help with this please
Dvinal [7]

Answer:

legs

Explanation:

All the animals in group one have legs while the ones in group 2 don't

8 0
3 years ago
What is the smallest size category of soil
Sergeeva-Olga [200]
B. Clay particles are the smallest
8 0
4 years ago
Read 2 more answers
A doctor sees a patient who has kidney failure lack of motor coordination
eimsori [14]

Answer:

What's the question????

6 0
3 years ago
Which of the following is a property of the stem of a dicot plant?Select one of the options below as your answer:A. ground tissu
Elodia [21]
I think the correct answer from the choices listed above is option A. A property of the stem of a dicot plant is that the ground tissue is differentiated into pith and cortex. Vascular bundles are not arranged sporadically instead arranged in a ring. Also, cambium does exist between xylem and phloem.
4 0
4 years ago
How do strides indicate whether the walker is a male or female?
Daniel [21]

men have a wider walk versus females who walk with there legs together. also men often have longer legs. so longer strides, male

shorter strides, female

8 0
3 years ago
Other questions:
  • Why are regions where convection currents diverge more suitable for building geothermal power stations?
    6·2 answers
  • When a neuron is at rest, what element is found in abundance outside the cell membrane?
    15·1 answer
  • PLEASE HELP!!
    7·1 answer
  • Which of these are electromagnetic waves?
    11·1 answer
  • In natural selection, _____ determine which phenotypes are successful.
    14·1 answer
  • In an experiment designed to measure the distance a golf ball is hit by clubs made of different material, a standardized variabl
    9·1 answer
  • Ou are studying evolution by drift of coat color in two other wild populations of Dornish Sand Steeds. One population lives near
    13·1 answer
  • TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA
    12·1 answer
  • Which best represents an example of carbon fixation?
    5·2 answers
  • What types of powers are shared by the federal and state governments
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!