1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
pav-90 [236]
1 year ago
13

True or false? glaciers on top of large earth masses can make the earth mass float upward

Biology
1 answer:
MatroZZZ [7]1 year ago
5 0

Answer: False

Explanation: Glaciers are massive bodies of slowly moving ice. Glaciers form on land, and they are made up of fallen snow that gets compressed into ice over many centuries. They move slowly downward from the pull of gravity.

You might be interested in
3. Summarize why the definition of species had changed over time
Tasya [4]

Answer:

Originally, the distinction was based on morphological differences. However, it soon became that some types of organisms had different forms at various stages in their lives, here is why

Explanation:

changed genes is passed on to the next generation. Most mutations are bad, but some of them make the organism more successful in its life. Organisms that inherit that favorable new gene are likely to become more abundant than others of the species. (geologic times)

3 0
3 years ago
After a rare fur color mutation occurred, a mice population evolved to have this new coat coloration (i.e. over many generations
julia-pushkina [17]

Answer:

predation

Explanation:

If the first coat color is black for example, the mice will be able to hide away in a dark area or corner, they will also be able to move around at night almost undetected. Changes in environment, such as development and introduction of street lighting may cause these mice to be easily seen by predators. These mice will quickly be eaten by predators now that they are accessible. On the other hand mice that have a different color such as white or grey will be able to blend in better with the new surroundings. These mice will pass along this trait to their progeny and the new coat color will proliferate.  

7 0
3 years ago
Read 2 more answers
Which is a hypothectical string theory weightless particle
finlep [7]
Gravitron is a hypothetical String Theory Weightless Particle.
4 0
3 years ago
he sequence of this single strand of DNA is ATTCGGCTATTTACGATTGCCAT. To complete this model, what should the nucleotides on the
Ugo [173]

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

Adenine (A) pairs with Thymine (T) [Apples grow on Trees]

Cytosine (C) pairs with Guanine (G) [Cows eat Grass]

Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair

ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand

TAAGCCGATAAATGCTAACGGTA ------- New strand

5 0
3 years ago
In grassland regions, rainy seasons and drought seasons determine, in part, the _____.
7nadin3 [17]
Kinds of resident organisms.
3 0
3 years ago
Read 2 more answers
Other questions:
  • What use do u think extracting DNA might have today
    14·2 answers
  • What must a cell do first to divide successfully? A.duplicate its genetic information B.increase its ratio of surface area to vo
    10·2 answers
  • All chordates have _____ (at some point in their life cycle). feathers diaphragm fins pharyngeal pouches
    14·1 answer
  • Table salt is the result of a(n) _____.
    14·1 answer
  • Explain how the terms atom, compounds, element, and molecules all relate to one another
    14·1 answer
  • Fish lay thousands of eggs in one reproductive cycle. What are some factors that prevent the majority of these eggs from develop
    13·1 answer
  • The ability to fuse one's identity with that of another without fear of losing it characterizes what erikson called
    10·1 answer
  • PLEASE HELP THEIR JUST TWO SMALL QUESTIONS!!!!!
    10·1 answer
  • Could someone help me with this please
    13·2 answers
  • What is element. give 3 example​
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!