Answer:
Originally, the distinction was based on morphological differences. However, it soon became that some types of organisms had different forms at various stages in their lives, here is why
Explanation:
changed genes is passed on to the next generation. Most mutations are bad, but some of them make the organism more successful in its life. Organisms that inherit that favorable new gene are likely to become more abundant than others of the species. (geologic times)
Answer:
predation
Explanation:
If the first coat color is black for example, the mice will be able to hide away in a dark area or corner, they will also be able to move around at night almost undetected. Changes in environment, such as development and introduction of street lighting may cause these mice to be easily seen by predators. These mice will quickly be eaten by predators now that they are accessible. On the other hand mice that have a different color such as white or grey will be able to blend in better with the new surroundings. These mice will pass along this trait to their progeny and the new coat color will proliferate.
Gravitron is a hypothetical String Theory Weightless Particle.
Answer:
TAAGCCGATAAATGCTAACGGTA
Explanation:
Adenine (A) pairs with Thymine (T) [Apples grow on Trees]
Cytosine (C) pairs with Guanine (G) [Cows eat Grass]
Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair
ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand
TAAGCCGATAAATGCTAACGGTA ------- New strand
