1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ivanshal [37]
1 year ago
15

Pick out the correct sentences that correctly characterize marine reptiles.

Biology
1 answer:
KIM [24]1 year ago
8 0

Answer:

Their skin prevents salt from entering their bodies.

Explanation:

You might be interested in
Which of these is a producer?
Svetradugi [14.3K]

Answer:

Plants sre the producers.

Explanation:

5 0
4 years ago
Read 2 more answers
Entamoeba histolytica can cause keratitis if it is introduced through an abrasion in the conjunctiva
inysia [295]

The given statement was False: A hookworm infestation frequently leads to anemia.

what is entamoeba histolytica ?

The parasitic anaerobic amoebozoan Entamoeba histolytica belongs to the genus Entamoeba. E. histolytica, which mostly infects humans and other primates and causes amoebiasis, is thought to infect between 35 and 50 million individuals globally. It is believed that E. histolytica infections cause more than 55,000 fatalities annually. Prior to the discovery that at least 90% of these illnesses were caused by a second species, E. dispar, it was believed that 10% of the world's population was affected. Although animals like dogs and cats can briefly contract the disease, it is not believed that they significantly contribute to its spread.

Histolysis literally translates to "dissolution and disintegration of biological tissues."

as the given statement was False, "A hookworm infestation commonly results in anaemia."

To learn more about entamoeba histolytica follow the given link: brainly.com/question/14435883

#SPJ4

3 0
1 year ago
Please help!! Null and alternative hypotheses and chi square. Please DO NOT give a fake garbage answer so you can get the points
lisabon 2012 [21]
I don’t know about alternative or chi square but a bull hypothesis from what I know is saying that your claim or thesis is wrong.

I hope that helped. :)
5 0
3 years ago
What ecological roles are performed by cyanobacteria?
Anvisha [2.4K]
Cyanobacteria are also very often referred to as "blue-green algae" because they are photosynthetic and aquatic in nature. They are important in the ecology as they help in forming the earth's oxygen atmosphere. Many oil deposits are attributed to the activities being performed by this group of microorganisms. 
4 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Other questions:
  • Which is not a disease contracted through contaminated water
    12·1 answer
  • "the medulla, the pons, and the cerebellum are three main parts of the ______."
    5·2 answers
  • identify solar wind nuclear and tidal power as nonrenewable or renewable energy resources. Explain your answer.
    12·2 answers
  • What is the ability of a membrane to allow materials to pass through called
    11·1 answer
  • Which statement best relates why these animals have so much blubber?
    9·1 answer
  • Which of the following correctly summarizes why bacteria and archaea are not in the same kingdom? . . A. Only archaea have cell
    7·2 answers
  • 28. What two nonpolar gases do we exchange when performing
    10·1 answer
  • A hand cranked flashlight represents:
    5·1 answer
  • Pls help with this !!!!!!
    14·1 answer
  • A field of meadow buttercups has been divided into a grid of 308 squares. Random sampling is used to sample 20 of the grid squar
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!