1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
VLD [36.1K]
2 years ago
11

TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.

Biology
1 answer:
netineya [11]2 years ago
5 0

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

You might be interested in
The genes for miniature wings (m) and garnet eyes (g) are approximately 8 map units apart on chromosome 1 in Drosophila. Phenoty
Anestetic [448]

The following phenotypic classes reflect offspring that were generated as a result of a crossover event

  • wild type
  • miniature wings
  • garnet eyes

Explanation:

When the miniature wings and garnet eyes links up with the 8 map unit that are present between them. After that the presence of two recombinant classes must complement together and make 8% of total i.e. they contribute 4% each. together the parental classes make up to 92% by contributing 46% one.

This can be understood through a phenotypic ratio calculation, which can be expected from it.

wild type: 4% x 800 = 32

miniature wings: 46% x 800 = 368

garnet eyes: 46% x 800 = 368

miniature wings, garnet eyes: 4% x 800 = 368

5 0
2 years ago
A word for the first settlements, formed when humans began to domesticate plants and animals
Tamiku [17]
<span>"Village" is the term used to refer to the first settlements formed as humans began domesticating plants and animals.

A village is comprised of a clustered human settlement or community, with a few hundred to a few thousand people. It is typically smaller than a town but larger than a hamlet and is usually a permanent settlement, with dwellings spaced closely from each other. The surrounding lands were usually farmed, but in the case of traditional fishing villages, they were located adjacent to fishing grounds as well. </span>
7 0
2 years ago
Antibiotics added to livestock feed have been found to:
solong [7]
Antibiotics added to livestock feed have been found to increase their growth rate, reduce incidence of infection, reduces mortality and improve feed conversion ratio or feed efficiency.
7 0
2 years ago
Which of the following systems use the cardiovascular system for the transport of materials? excretory system digestive system e
Lady_Fox [76]

Answer:

Endocrine System

Explanation:

5 0
2 years ago
Read 2 more answers
Can the shape of globin change ?
marissa [1.9K]

Answer:

People with the sickle cell mutation in both copies of the HBB gene produce proteins that clump together and lead to changes in the shape and behavior of red blood cells.

7 0
1 year ago
Other questions:
  • In the Olestra potato chip experiment, the report published in the Journal of the American Medical Association in January 1998 i
    12·1 answer
  • What are the benefits, risks and ethical concerns about biotechnology?
    10·2 answers
  • • why is gc typically limited to molecules that weigh less than 400 amu?
    5·1 answer
  • Which molecule is metabolized in a cell to produce energy "currency" in the form of atp? hints which molecule is metabolized in
    12·1 answer
  • How many years does it take for the sun to pass the earth
    9·1 answer
  • A __________ solution is a medium in which the overall concentration of solutes equals that found inside the cell. water enters
    6·1 answer
  • In cocker spaniels, the allele for black coat color (B) is dominant over the allele for brown coat color (b) if a brown cocker s
    8·1 answer
  • Why does lymph need to flow more slowly through the lymph nodes?
    5·2 answers
  • Can earthquake sensors detect tsunamis​
    6·1 answer
  • Help please! Will give brainliest.
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!