1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
VLD [36.1K]
3 years ago
11

TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.

Biology
1 answer:
netineya [11]3 years ago
5 0

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

You might be interested in
Nervous system found in simpler animals like jellyfish.
Flura [38]
<span>The answer is nerve net.

Jellyfish has a nerve net that surrounds its whole body. It makes a series of interconnected neurons that form net-like structure. This net surrounds the whole body of the jellyfish. Some jellyfish may have sensory structures, motor nerve net, and diffuse nerve net. Sensory structures receive environment signals and send them through diffuse nerve net to motor nerve net that activates muscle contractions.</span>
7 0
4 years ago
Explain why a volcano is created when oceanic and continental crust collide. Makes sure you include what
pav-90 [236]

Oceanic crust or a less solid piece of oceanic crust will subduct beneath continental crust. Earthquakes occur when the oceanic plate subducts into a trench. Volcanoes are created by the melting of mantle material.

<h3>What does oceanic crust mean?</h3>

The outermost part of the Earth's lithosphere, known as oceanic crust, is created at spreading centres on oceanic ridges that are found at divergent plate boundaries and is found beneath the oceans. The oceanic crust is roughly 4 miles (6 km) thick. Even without the sediment on top, it is made up of many layers.

<h3>What is a characteristic of oceanic crust?</h3>

Compared to continental crust, oceanic crust is both thinner and denser. This is because to the oceans' weight, which has compacted it beneath it. It is also much more recent than continental crust, typically existing within the last 200 million years.

To know more about Oceanic crust visit:

brainly.com/question/1101764

#SPJ13

5 0
1 year ago
Part 4 - Natural Selection and Adaptations
levacccp [35]

Answer:

ejfjfisioakendififidishwhej

4 0
3 years ago
Which scientist was responsible for coining the phrase "Big Bang"? *
Molodets [167]

Answer:

Fred Hoyle

Explanation:

Sir Fred Hoyle FRS was an English astronomer who formulated the theory of stellar nucleosynthesis. He also held controversial stances on other scientific matters—in particular his rejection of the "Big Bang" theory, a term coined by him on BBC radio, and his promotion of panspermia as the origin of life on Earth

5 0
3 years ago
Read 2 more answers
is a complex mixture of weathered minerals materials from rocks, partially decomposed organic molecules, and a range of living o
jeka57 [31]
It's yo mf momma. ya feel me now. 



3 0
3 years ago
Other questions:
  • All hypotheses are valuable, even if they turn out not to be true. Which answer does NOT support this statement?
    7·1 answer
  • In the carbon cycle, carbonate rocks would be most likely to be part of the which of earth's spheres?
    12·1 answer
  • What does the dotted line between the water molecules represent?
    11·1 answer
  • If an animal learns to use a tool in one way and then is presented with a new situation in which it applies the tool, the animal
    9·1 answer
  • When jumping into water you notice resistance. this resistance is caused by water's __________?
    5·1 answer
  • Where are all my fellow gays??
    12·2 answers
  • Why are cells called the “basic building blocks of life?”
    6·1 answer
  • Explain how photosynthesis illustrates these general principles.
    11·1 answer
  • Name the two kinds of particles that make up a water particle
    11·2 answers
  • HELP ITS DUE TODAY put the number by which one you answer!!!!
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!