1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
VLD [36.1K]
2 years ago
11

TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.

Biology
1 answer:
netineya [11]2 years ago
5 0

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

You might be interested in
How does lymph return to the circulatory system from the lymphatic system? (2 points)
zhannawk [14.2K]

Answer:

It drains into a larger lymph trunk, which returns it to the subclavian veins.

Explanation:

5 0
2 years ago
Read 2 more answers
Choose a symbiotic relationship from the list below. Research the relationship and write a 300 word report that includes the ben
ser-zykov [4K]

Symbiotic Relationships : A long term relationship between two biotic factors, where at least one benefits





Mutualism= symbiotic relationship where both organisms benefit (+,+) o Example- rhino & woodpecker (rhino gets rid of parasites and bird gets food) 



Parasitism = symbiotic relationship where one benefits and the other is harmed, but not typically to the point of death (+,-) o Example- tapeworm in an animal, tick or flea on a dog (parasite benefits at the expense of the host) 




Commensalism = symbiotic relationship where one benefits and the other is neither helped nor harmed (+, 0) o Example- barnacles on a scallop (barnacles get a habitat/place to attach while the scallop is not hurt or helped by their presence).



















Symbiotic Relationships:

In symbiosis, two or more species live together in a close, long term association. Symbiotic relationships can be beneficial to both organisms or may benefit one organism and leave the other harmed or unaffected. Parasitism is one type of symbiotic relationship that is detrimental to, or harms, the host organism. In this relationship, one organism feeds on and usually lives in another, typically larger, organism. Mutualism is a symbiotic relationship in which both participating species benefit. A well known instance of mutualism involves ants and aphids. The ants feed on fluid the aphids secrete, and in exchange, the ants protect the aphids from insect predators. A third from of symbiosis is commensalism, a symbiotic relationship in which one species benefits and the other is neither harmed nor helped. Among the best-known examples of commensalism are the feeding and protection relationships between certain small tropical fishes and sea anemones, marine animals that have stinging tentacles.








Hope that helps!!!!!! :)


6 0
3 years ago
Read 2 more answers
There are several genetic disorders that occur in many organisms where the chromosomes do not sperate properly in meiosis which
pashok25 [27]
Anaphase 2 is the correct answer.
5 0
3 years ago
Read 2 more answers
If you sustain an injury to the shoulder joint (infraspinatus muscle) how would it affect the movement of the shoulder?
maks197457 [2]

There are so many examples for that in different areas, like Perylene experiment carried out in our lab recently.Here's one link: http://www.alfa-chemistry.com/perylene-cas-198-55-0-item-282870.htm

4 0
3 years ago
Hich physiologic change increases cardiac work but does not enhance cardiac output?
Ugo [173]

Increased afterload physiologic change increases cardiac work but does not enhance cardiac output.

<h3>What about cardiovascular system?</h3>
  • Heart and blood vessels, which make up your cardiovascular system, deliver oxygen and nutrition to your body's organs so they can function.
  • Blood vessels also transport waste such as carbon dioxide to be disposed.
  • Conditions affecting the heart or blood vessels are collectively referred to as cardiovascular disease.
  • It is frequently associated with atherosclerosis, an accumulation of fatty deposits in the arteries that increases the risk of blood clots.
  • The heart, blood arteries, and blood make up the cardiovascular system.
  • Its main job is to carry deoxygenated blood back to the lungs and to carry nutrients and oxygen-rich blood to all regions of the body.
  • The most typical cause of coronary artery disease is atherosclerosis, which is a buildup of fatty plaques in your arteries.
  • Atherosclerosis can be brought on by unhealthy lifestyle choices such smoking, being overweight, not exercising, and eating poorly.

Learn more about cardiovascular system here:

brainly.com/question/946975

#SPJ4

6 0
1 year ago
Other questions:
  • Which of the following increases genetic variation within a population and causes change
    7·2 answers
  • What are karyotypes? How are they different than Punnett squares?
    5·1 answer
  • Skin prevents your body from losing water and helps it maintain its proper temperature. It also secretes the hormone calcidiol T
    6·1 answer
  • Suppose babies born after a gestation period of 32 to 35 weeks have a mean weight of 2500 grams and a standard deviation of 800
    15·1 answer
  • 2 places ribosomes are located
    7·1 answer
  • Why do you think death rates were so high?give two reasons
    13·1 answer
  • Describe why trasnsitioning to a hydrogen economy has advantages.<br> PLEASE HELLPPPPP
    15·2 answers
  • PLEASE HELP!!!!! WILL GIVE BRAINLIEST!!!!
    7·1 answer
  • Organisms that are made up of prokaryotic cells are NOT ____________. Question 5 options: Simpler than organisms made up of Euka
    9·1 answer
  • Phospholipids are found in plasma membranes. are water-soluble. contain subunits called amino acids. are fat-soluble vitamins. a
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!