1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
VLD [36.1K]
2 years ago
11

TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.

Biology
1 answer:
netineya [11]2 years ago
5 0

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

You might be interested in
Which statement BEST supports the author's analysis that unshelled fish are more challenging game? A) And, fish or no fish, ther
In-s [12.5K]
B; An unshelled fish is lively and elusive past the power of words to portray, and in this, undoubtedly, lies its desirability.
6 0
3 years ago
Read 2 more answers
Why are 4 H+ needed for every ATP synthesized and exported by mitochondria, even though only 3 H+ need to be translocated by the
kykrilka [37]

Answer: One H⁺ ion ie required in converting ATP and inorganic phosphate to ATP

Explanation:During oxidative phosphorylation, high energy electrons released by hydrogen carriers are shuttled through the electron transport chain. The released energy is used to translocate 3 H+ ions from the matrix, creating an proton motive force, which will cause 1 H+ ion to move down the electrochemical gradient and diffuse back into the matrix (chemiosmosis) which is facilitated by ATP synthase. As the H+ moves through the ATP synthase this triggers the molecular rotation of the enzyme, synthesizing ATP

8 0
3 years ago
Which one is it ?!?
xeze [42]
White blood cell is the answer
6 0
3 years ago
Read 2 more answers
Suggest ways that plants could be altered to improve the world's food supply. Hint: The first sentence should express the main i
nydimaria [60]
More growth of flowers and or more plant food/water supply for it
8 0
3 years ago
Read 2 more answers
Low elevation and low latitudes result in ____________________
DiKsa [7]

Answer:

5

Explanation:

4 0
2 years ago
Other questions:
  • What is responsible for determining which direction water will diffuse across the plasma membrane of cells?
    9·1 answer
  • It is better to grow plants in soil than in sand because soil
    6·2 answers
  • Why was the founder species of finches on the Galapagos islands able to form such a large variation of beak types?
    15·1 answer
  • Which statements about salt water are true? Check all that apply.
    11·1 answer
  • Planets with atmospheric ________ are warmer than those without.
    8·1 answer
  • Which label belongs in the region marked X?
    7·1 answer
  • Explain the lifecycle of mosquito in short​
    11·1 answer
  • Is natural selection the only component of darwin's theory of evolution
    6·1 answer
  • Process of diffusion​
    8·1 answer
  • What effect have human activities had on the ozone layer?
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!