1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
VLD [36.1K]
3 years ago
11

TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.

Biology
1 answer:
netineya [11]3 years ago
5 0

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

You might be interested in
Transport a victim of heat exhaustion to a medical facility if no improvement is seen within:
malfutka [58]
Within 30 minutes the victim of a heat exhaustion needs to be transported to a medical facility if no improvement has been seen. Heat exhaustion is a condition in where symptoms like rapid pulse and heavy sweating can be seen. Heat cramps would be the mildest and heatstroke is the most severe.
6 0
4 years ago
What does a liver cells shape say about what it does.
vaieri [72.5K]
The cells are polygonal in shape and their sides can be in contact either with sinusoids (sinusoidal face) or neighboring hepatocytes (lateral faces). A portion of the lateral faces of hepatocytes is modified to form bile canaliculi.

The liver filters all of the blood in the body and breaks down poisonous substances, such as alcohol and drugs. The liver also produces bile, a fluid that helps digest fats and carry away waste. The liver consists of four lobes, which are each made up of eight sections and thousands of lobules (or small lobes).

7 0
3 years ago
What caused the inflationary period in the big bang?????<br><br> PLs helppppppppppp PLSSS
Lunna [17]
Cosmic inflation caused the inflationary period
6 0
3 years ago
Is shale Intrusive/ Extrusive?
Flauer [41]
I think it is extrusive but I am not completely sure


3 0
3 years ago
The amount of water vapor in the air would not be high near ______________.
stiks02 [169]
The amount of water vapor in the air would not be high near <span>a.)deserts. i hope this help. have a good day:)

</span>
7 0
3 years ago
Read 2 more answers
Other questions:
  • What could be a result of an injury to the dorsal column? loss of sensation to pressure and touch loss of control over all invol
    7·2 answers
  • Explain the relationship between plants and fossil fuels
    15·1 answer
  • To transform bacteria with plasmids, technicians first make the bacteria competent (capable of taking up DNA) by placing them in
    12·1 answer
  • What are 2 suffixes that the scientific sugar names end with?
    12·1 answer
  • Which of these conditions made it beneficial for aquatic plants to move onto land?
    12·1 answer
  • How many ATP's are required to start glycolysis anf how many ATP's are produced?
    12·1 answer
  • Which of the following factors can be representative of a population near carrying capacity?
    6·1 answer
  • Help pleeeeeeeeeeeeeeeaaaaaaasssssseeeeeee.
    14·1 answer
  • Can someone help me asapp
    15·1 answer
  • *Ways we turn hydropower into energy we can use:
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!