1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
VLD [36.1K]
3 years ago
11

TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.

Biology
1 answer:
netineya [11]3 years ago
5 0

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

You might be interested in
Suppose you are a planner who is working for the German government. You & other planners must decide how to use tax money to
s344n2d4d5 [400]

Answer:

Yes

Explanation:

Geothermal is renewable energy generated from the Earth's heat. If anything, the Earth will continue to release heat until the sun blows up in a billion years (unless something is wrong with the Earth lol)

4 0
3 years ago
Read 2 more answers
Sunlight includes three types of light. Describe each one
dusya [7]

Answer:

Visible light, ultraviolet light and infrared light

3 0
3 years ago
Read 2 more answers
What is the definition of cranial
Luba_88 [7]

Explanation:

nerves that emerge directly from the brain. Cranial nerves relay information between the brain and parts of the body, primarily to and from regions of the head and neck.

3 0
3 years ago
What does the atomic mass of a element represent ??
BlackZzzverrR [31]

Answer:

ans is c is correct pls mark me as brainlist pls

6 0
3 years ago
What are the reactants in cellular respiration? what are the products?
Gwar [14]
Cellular respiration is the process of releasing energy from the food that one had taken. The reactants of the cellular respiration were both oxygen and glucose. The main product of this process would be ATP (adenosine phosphate) but could also be H2O and CO2. 
3 0
4 years ago
Read 2 more answers
Other questions:
  • Which of the following is a necessary trait of a good hypothesis?
    15·1 answer
  • 6. What role does gravity play in the water cycle?
    6·1 answer
  • Cells burn glucose molecules in a process called
    13·1 answer
  • ​between birth and adulthood the brain ______ in volume.
    14·1 answer
  • Are carriers that consist of monoglycerides, fatty acids, and lecithin, and serve to transport digested fats from food to the in
    7·1 answer
  • Which of the following accurately describes the term fossil fuels?
    14·1 answer
  • Which of these describes a population?
    12·2 answers
  • If researchers learned how to control emotional responses so that targeted emotions could be caused or prevented, what ethical c
    7·1 answer
  • Brainliest to best answer (as always if u answer any of my questions)!
    6·2 answers
  • How can I describe the yearly temperatures of the Tundra biome?
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!