1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
VLD [36.1K]
2 years ago
11

TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.

Biology
1 answer:
netineya [11]2 years ago
5 0

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

You might be interested in
Describes a solution in which extracellular fluid has higher osmolarity than the fluid inside the cell
Gennadij [26K]
Hypertonic solution, such as increased salt (NaCl) from diet, or from hyperglycemia as in uncontrolled diabetes.
3 0
3 years ago
Which can support more weight paper or plastic grocery bags?
wariber [46]

The plastic bags held more weight compared to the paper bags. The breaking points for the plastic bags are the handles. The weak points for the paper bags are the bottom and sides of the bag. The plastic bags held more weight and could conform to different shapes and stretching characteristics.

5 0
3 years ago
How can the "shape" of a protein affect its function?
e-lub [12.9K]

Protein function is directly related to the structure of that protein. A protein's specific shape determines its function. if the structure of the protein is altered because of a change in the structure of the amino acids, the protein becomes denatured and does not perform its function as expected.

8 0
3 years ago
Read 2 more answers
There are marked differences in the type of organisms found at four different locations at the same tidal height along ta rocky
yawa3891 [41]

Answer and Explanation:

Many elements can be responsible for this, among them, we can mention the presence and absence of predators in the different places on the rocky coast. This is because predators can influence not only the number of organisms found, but also the types of organisms.

Another element that may be the cause of this variability is the availability of resources necessary for the life of these organisms, in addition, the impact of the waves on the rocks, can cause the variability of the organisms, since some may not be able to resist the impact of the waves.

7 0
2 years ago
What is the basic definition of evolution?
earnstyle [38]
The way animals or creatures change and adapt over time
6 0
2 years ago
Read 2 more answers
Other questions:
  • Where does a point lie if it is on a segment whose endpoints are on the sides of the angle, but it is not an endpoint of the seg
    8·1 answer
  • Ions form when _____________
    6·1 answer
  • If a chlorine atoms gains or loses a valence electron, it becomes a charged particle called a/an______?
    15·1 answer
  • What is the haploid number in sea otter?
    6·1 answer
  • PLEASE HELP ASAP I'M BEING TIMED!!!!!!!!!!!!!!!!!!!!!!!!! HELP ME RIGHT NOW, PLEASE!!!!!!!!!!!!!!
    11·2 answers
  • Select the correct answer.
    12·2 answers
  • Which of the following statements correctly describes the genetic material inside a virus?
    15·1 answer
  • Which three materials are exchanged with the environment through tiny
    10·1 answer
  • Endoplasmicreticulum defination
    15·2 answers
  • Hey guys morning or night whatever part of the world u are from..but morning I am from Nigeria.
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!