1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
VLD [36.1K]
3 years ago
11

TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.

Biology
1 answer:
netineya [11]3 years ago
5 0

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

You might be interested in
What type of diagram shows how energy moves in a eycosystem
Sloan [31]
A type of diagram that shows how energy moves in a ecosystem is a food chain
8 0
3 years ago
Are the anthers in this flower located above or below the stigma
Akimi4 [234]

Answer:

Above

Explanation:

The anthers are always above the stigma.

4 0
3 years ago
What is the very first thing an analyst reaches for when they find a tool mark?
lys-0071 [83]

Answer: C. Their camera

Toolmarks are the impressions left by an object or tool on it's contact surface.   Toolmarks are searched and collected in a crime scene to relate a link with the tool which has created them. In crime scene investigation, toolmarks found in the scene of crime should be photographed by the analyst in close range, mid range and overview range shots in order to record it's original location, shape, size and number if multiple tool marks are present.


7 0
3 years ago
Read 2 more answers
A hospital microbiologist isolates a pathogenic cocci which grows in chains. Based on the shape and arrangement of cells, she co
nordsb [41]

Answer:

Streptococcus

Explanation:

Coccus (plural cocci) bacteria are those that are oval or spherical in shape when viewed under a microscope. Coccus bacteria end up forming different shapes when they reproduce or multiply.

When they grow in clusters, they are referred to as Staphylococci, when in chains, they are streptococci and when they are arranged in pairs, they are diplococci. Enterococci are arranged in short chains or in pairs but usually gram positive in nature.

The correct option is streptococcus.

5 0
4 years ago
Read 2 more answers
A species of fly has two alleles for the length of their legs. The allele for long
stira [4]

Answer:

According to Hardy Weinberg law (p+q)2=1 where p is fequency of one allele and q is the frequency of another allele.

According the question

 q represent the short legs and 33 of 100 organism have short legs.

   As a result the frequency of q with respect to the 100 organism is 33/100

                                                                                                                  =0.33

Therefore q=0.33

 we all know that

            (p+q)2=1

             ∴  p+q= 1

             ∴  p=1-q

               p= 1-0.33

                   p=0.67

The frequency of p is 0.67

Explanation:

6 0
3 years ago
Read 2 more answers
Other questions:
  • Which sentence best represents the process through evolution occurs?
    6·2 answers
  • Bacteria consist of a single cell and have no nucleus. What are bacteria called? A. Organelles B. Multicellular C. Eukaryotes AN
    5·2 answers
  • Where is DNA found in eukaryotic cells?​
    11·1 answer
  • Chromosomes only exist inside gametes true or false
    7·1 answer
  • Which tool is used to track which organisms are carriers of a specific trait through several generations?
    9·2 answers
  • Suppose that the central c-g base pair in the dna molecule below is substituted by an a-t base pair. what is the most likely res
    10·1 answer
  • Scientists can use a _ to make good predictions
    15·1 answer
  • Which one is the best definition of an ecosystem
    8·1 answer
  • What happen to food and oxygen in the blood inside the heart if heart muscles are thick​
    7·1 answer
  • what is the significance of diffusion and osmosis in living organism ?give one example in support of your answer​
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!