1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
VLD [36.1K]
2 years ago
11

TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.

Biology
1 answer:
netineya [11]2 years ago
5 0

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

You might be interested in
What prescription medicine interactions make mdma usage dangerous
MakcuM [25]
Adderall


$3&3!:83!834!&44’fn
8 0
3 years ago
Describe the process of photosynthesis to explain at least 1 requirement for photosynthesis that would need to be considered for
baherus [9]

Answer:

the process by which green plants and some other organisms use sunlight to synthesize nutrients from carbon dioxide and water. Photosynthesis in plants generally involves the green pigment chlorophyll and generates oxygen as a by-product.

8 0
2 years ago
What types of microorganisms are considered a biological hazard
marusya05 [52]

Explanation:

Biological hazards include microorganisms such as bacteria, viruses, yeasts, molds and parasites. Some of these are pathogens or may produce toxins. A pathogenic microorganism causes disease and can vary in the degree of severity

8 0
2 years ago
A number of mosquito populations today are resistant to specific insecticides, even though those insecticides were highly effect
BabaBlast [244]
<h2>Answer is option "A"</h2>

Explanation:

  • Rehashed utilization of a similar class of pesticides to control a bug can cause unwanted changes in the genetic stock of a vermin prompting another type of counterfeit determination, pesticide opposition. At the point when a pesticide is first utilized, a little extent of the bug populace may endure introduction to the material because of their unmistakable hereditary cosmetics
  • These people go along the qualities for protection from the people to come. Resulting employments of the pesticide increment the extent of less-helpless people in the populace. Through this procedure of choice, the populace step by step creates protection from the pesticide. Around the world, in excess of 500 types of bugs, bugs, and arachnids have built up some degree of pesticide opposition
  • Hence, the right answer is option "A"
4 0
3 years ago
Name the subatomic particle that participates in chemical bond formation?
Natalka [10]
A type of strong chemical bond in which two atoms share one or more pairs of valence electrons. Two or more atoms held together by covalent bonds. The attraction that exists between opposing (positive and negative) charges within the atom.
4 0
3 years ago
Other questions:
  • Some green careers focus on innovations aimed at improving the quality of education. True False
    5·2 answers
  • The portion of the biosphere that consists of all earth's land is called the _____
    10·1 answer
  • Which statement is correct? The two tiles are not similar because segment SP is to segment SR is 4 : 7 and segment MJ is to segm
    9·2 answers
  • Mary has type A blood. Her son bill has type AB. Which blood type does bills dad have if hes homogenous for blood type?
    5·2 answers
  • Give reasons for the following.
    15·1 answer
  • What are the common parts of bacteria and their functions?
    12·1 answer
  • What do buffalo eat during the dry season
    6·2 answers
  • Which influence has immigration and migration had on the population of Texas?
    11·2 answers
  • 50 POINTS <br><br> How can the environment impact a particular population of a species?
    15·1 answer
  • I WILL GIVE 100 POINTS! PLUS BRAINLY!!! Starch, glycogen, and cellulose are all made of chains of
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!