1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
VLD [36.1K]
3 years ago
11

TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.

Biology
1 answer:
netineya [11]3 years ago
5 0

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

You might be interested in
Where the carbon dioxide in yeast come from?
Furkat [3]
Carbon dioxide from the yeast comes from a process called fermentation. Fermentation is a cellular respiration process in cells that happens when oxygen is not present. If oxygen is present, the process is called aerobic respiration. 
6 0
3 years ago
DNA replication occurs during which phase of the eukaryotic cell cycle?
wariber [46]

In eukaryotic cells the DNA can be found in the nucleus mainly. so DNA replication takes place in the nucleus during the S phase of the cell cycle.

Also in eukaryotic cells there are mitochondria and chloroplasts (plants) and these have circular DNA and they also get replicated (according to their own mechanism).

Prokaryotic cells don't contain a nucleus. They do not contain DNA in the cytoplasm and thus the DNA replication will take place here.

I really hope this helps!

3 0
3 years ago
Drag the terms on the left to the appropriate blanks on the right to complete the sentences. resethelp biomass assimilated feces
yaroslaw [1]

1. The right answer is not assimilated

The assimilation designates in biology the process by which substances and materials external to the body are transformed into substances and materials interior to the body.

2.  The right answer is feces.

Feces correspond to the residue of digestion that the intestine could not absorb. They consist of 80% water and 20% dry matter (intestinal cell debris, bacteria, cellulose that comes from the non-absorbable part of plants).

3. The right answer is assimilated  

The opposite of the first one.

4. The right answer is cellular respiration.

Cellular respiration is the process of cellular metabolism that converts the chemical energy contained in nutrients into ATP (adenosine triphosphate).

5. The right answer is assimilated

"Assimilation" can be also used for energy.

6. The right answer is biomass

In the field of energy, biomass is the organic matter of plant origin (microalgae included), animal, bacterial or fungal (fungi), usable as a source of energy.

7. The right answer is biosynthesis.

Biosynthesis consists of a formation and production of a chemical compound body by a living organism, usually due to the catalysis of an enzyme. For example, protein synthesis is the synthesis of organic substances by an organism. Chemosynthesis and photosynthesis are biosynthesis.

8. The right answer is non assimilated.

Since it is lost, so it is not assimilated by the organism.

9. The right answer is biosynthesis.

In ecology, the trophic level is the rank occupied by a living being in a food web. It is measured in some way by the distance separating this being from the basic level which is that of the primary autotrophic production.

Above this basic level, each link (or stage) of a food chain corresponds to a trophic level.

8 0
3 years ago
Read 2 more answers
Weather conditions that are characteristic of a region or of a particular place over a long period of time. *
harkovskaia [24]
This is the definition of climate
6 0
3 years ago
Which fossil organism in whale evolution was the first to live mostly in water?
balu736 [363]
During the research Ambulocetus would be the first to consistently stay in water and Set over time they developed feet arms and <span>hands used to swim.</span>
5 0
3 years ago
Other questions:
  • Ovulation typically occurs ________ days before the menstrual period begins. question 90 options: 7 10 20 14
    6·2 answers
  • In the figure, what does letter "B" represent?​
    12·1 answer
  • Can anyone help me with this?​
    14·2 answers
  • Which of the following kingdoms contains prokaryotes? a. protista b. eubacteria c. plantae d. fungi
    15·2 answers
  • Carbohydrates contain many sugar molecules linked together.<br> a.simple<br> b.complex
    8·1 answer
  • Pls help asap
    13·1 answer
  • 3) In mice, brown eyes (B) are dominant over blue (b). A homozygous brown-eyed male mouse mates with a blue-eyed female and they
    5·2 answers
  • What is one function of plant stems?
    11·2 answers
  • What is the main driving force for surface ocean currents?
    15·2 answers
  • Some organisms can become _____ to survive an unsuitable environment.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!