1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
VLD [36.1K]
3 years ago
11

TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.

Biology
1 answer:
netineya [11]3 years ago
5 0

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

You might be interested in
Which of the labeled structures is an adaptation that is primarily responsible for helping a paramecium control its water balanc
agasfer [191]
The answer is actually structure B
7 0
3 years ago
Which of the following is an enzyme required by the process of rephosphory,to create ATP? A) AD Pase B)AT Pase C)Polymerase D)AT
iren [92.7K]

ATPase is the enzyme which is required to create ATP and is denoted as option B.

<h3>What is ATPase?</h3>

This type of enzyme is found in the mitochondrion and catalyzes the formation of ATP which provides energy to cells.

The ATP which is referred to as adenosine triphosphate is formed from the molecules known as ADP and inorganic phosphate which are present in the body cells. This ensures that the daily energy needs of the body are met.

Read more about ATPase here brainly.com/question/250287

#SPJ1

8 0
2 years ago
What is the sequence of bases on DNA strand b from left to right<br> (See picture)
VLD [36.1K]

Answer:

DNA sequence from left to right

T G A G G A C T T

Explanation:

There are four DNA nitogenous base they include thymine, guanine, cytosine and Adenine. The Nitrogenous bases are complementary that is Adenine is complementary to thymine and cytosine is completely to quanine and they both can replace each other in this manner A-T,C-G and it means that Adenine can pair with thymine and cytosine can only pair with guanine. DNA is known as Deoxyribonucleic acid. DNA sequencing are shown usually from the 5' end to the 3' end . The sense strand in DNA is used in DNA sequences and also it has the antisense strand and also called the coding strand and the non-coding strand are information are contained in the sequence

3 0
4 years ago
Read 2 more answers
Which of the following molecules stores a cell's hereditary information?
antoniya [11.8K]
DNA
Nucleic Acids are the basis for the storage and transmission of hereditary information in all cells. Determines a cell's function and manufactures proteins & enzymes. Encodes instructions for making proteins and RNA. DNA stores the “operating instructions” for a cell.
5 0
3 years ago
What are Constant/control variables
Alik [6]

Answer:

constant = changes and control is used as the basis of comparison

Explanation:

Constant variables are variables that do not change

e.g such as the temperature ( if it's meant to be kept at a constant temp).

Control variables are meant to be kept constant to allow for a comparison and thus determine the effect of IV (independant variable) and DV ( dependant variable)

4 0
3 years ago
Other questions:
  • Which description applies to the prominent transverse lines located on the anterior surface of the sacrum?
    7·1 answer
  • Which is the best example of a pure substance? a) peanuts b) milk c) gold d) air?
    11·2 answers
  • A scientist is studying the population of a particular species of beetle in an ecosystem. The beetles currently have an estimate
    12·1 answer
  • Which of the following is a reactant of Aerobic cellular respiration?
    11·1 answer
  • When skin cells have third-degree burns, skin grafts are used. What is the benefit to using skin grafts?
    7·2 answers
  • Glycolysis and the citric acid cycle comprise two different sets of oxidation reactions. thereaction sequence for glycolysis is
    6·1 answer
  • Kimberly is observing the behavior patterns of a bird species in the wild. During her observational period, a forest fire sweeps
    7·1 answer
  • To which substance does ferredoxin transfer an electron?
    14·2 answers
  • Which statement best describes evolution in a population?
    11·2 answers
  • Which type of transport would help the hydrogen ions become more concentrated?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!