Mars and Earth are very different planets when it comes to temperature, size, and atmosphere, but geologic processes on the two planets are surprisingly similar. On Mars, we see volcanoes, canyons, and impact basins much like the ones we see on Earth
Answer:
You tell her that this is incorrect.
Explanation:
The given information is incorrect as both small and large ribosomal subunits are required for protein synthesis. The eukaryotic ribosomes have E, P, and A sites. The A and P sites bind to the aminoacyl tRNA that carry the amino acid encoded by the codon of the mRNA.
The formation of peptide bond occurs between the amino group of amino acid in A site and the carboxyl group of amino acid present on P site. Both 40S and 60S subunit of ribosome contribute the A and P sites.
Answer: Kidney
Explanation: The Kidneys produce the hormone in response to cellular hypoxia due to loss of blood.
<span>The answer is D. Both fungi and plants can
grow in soil.</span>
<span>
Through the process of elimination:
- Plants are autotrophic organisms while fungi are heterotrophic organisms.
- Plants have vascular tissue, and fungi don't.
- Fungi are the only organisms that have cell walls made of chitin.
Therefore, the correct choice is that both fungi and plants can grow in soil.</span>
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'
adenine becomes uracil hope this helped :)
