1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Maru [420]
3 years ago
14

A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT…

Biology
1 answer:
padilas [110]3 years ago
4 0

Answer:

Explanation:

a. The template strand is:

ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT

The coding strand is

TGCCGTTCTAGGGTGGGATTAGTCTGGCATGGTAAGTGGAGGA

The sequence encoding the five amino acids is: 3' CTA-ATC-AGA-CCG-TAC-CAT 5'

b. 5' AUG-GUA-CGG-UCU-GAU-UAG 3'

c. N terminus Met-Val-Arg-Ser-Asp C terminus

d. GGAGGA

e. The shine Delgarno sequence as a mRNA binding site for mRNA's binding to the small subunit ribosome.

You might be interested in
Given what you know about the specific heats of various substances, why are pots and pans made of metal
OlgaM077 [116]
Cooking utensils need to be able to conduct heat well. Metal pots and pans are made out of the types of metals that make them such. This same type of metal though does not react chemically when placed in contact with heat. This characteristic is important when preparing food so as not to alter the taste. This is the reason why pots and pans are made out of metal.
8 0
3 years ago
True or False: The typical fre burns in an X pattern and moves upward in search of oxygen
Inga [223]

Answer:

True

Explanation:

Why do people ask you to drop and roll when theres a fire? because the smoke of the fire rises upwords. Hope this helped

7 0
3 years ago
Without doing any further work, comment on what conclusions you could draw if you conducted a test of the null hypothesis that t
Natalka [10]

Answer:

The null hypothesis is incorrect.

Explanation:

The null hypothesis is incorrect because the average number of bacteria did not remain the same at the source and at the outlet. We know that bacteria reproduce in a very less time and they use reproduction methods such as binary and multiple fission so with the passage of time, the population of bacteria increases and did not remain the same at the source and at the outlet.

5 0
3 years ago
Movements of water where density increase underwater causes deep currents
Norma-Jean [14]

they're called tides caused by the moon. the answer is tides

8 0
3 years ago
Read 2 more answers
The world's greatest super power
vladimir2022 [97]
America, Russia or China.
Probably America though.
6 0
3 years ago
Read 2 more answers
Other questions:
  • What happens to alcohol after it enters the human body
    13·2 answers
  • DNA strandof T A C C A T A T T
    8·1 answer
  • A nurse is reviewing a client's medication history. which drug would the nurse identify as placing the client at risk for ototox
    11·1 answer
  • What is deductive reasoning? What is the purpose of the deductive approach to the scientific method?
    8·1 answer
  • What is the genus of the popular fossils which are similar to "lucy"?
    10·2 answers
  • 16. Inhalation includes the act of A. pulling air in during breathing. B. moving of air out of the lungs. C. releasing air durin
    11·1 answer
  • 14.) When penicillin was first introduced, it was very effective in destroying 0 points
    5·1 answer
  • Cual es la diferencia entre el agua de mar y el agua del consumo humano?<br>​
    15·1 answer
  • Why is taking action for global warming important? please help
    14·2 answers
  • A mutation has occurred! Either a mistake in replication, transcription, or translation, or mutagen caused a change in the genet
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!