1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Maru [420]
3 years ago
14

A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT…

Biology
1 answer:
padilas [110]3 years ago
4 0

Answer:

Explanation:

a. The template strand is:

ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT

The coding strand is

TGCCGTTCTAGGGTGGGATTAGTCTGGCATGGTAAGTGGAGGA

The sequence encoding the five amino acids is: 3' CTA-ATC-AGA-CCG-TAC-CAT 5'

b. 5' AUG-GUA-CGG-UCU-GAU-UAG 3'

c. N terminus Met-Val-Arg-Ser-Asp C terminus

d. GGAGGA

e. The shine Delgarno sequence as a mRNA binding site for mRNA's binding to the small subunit ribosome.

You might be interested in
Do you now notice any signs of growth? In which part of the ginger piece do you
vampirchik [111]

is there a picture near the question?

8 0
3 years ago
An increase in herbivore populations in an ecosystem will soon lead to
Angelina_Jolie [31]
Increasing predator population
4 0
3 years ago
Read 2 more answers
76.
yarga [219]

Answer:

Happy cats blink eyes, keep whiskers forward and tail relaxed; Aggressive Cat lowers tail and make it stiff, crouches etc; an Angry cat is rigid and curls itself around its body and a Depressed cat sleeps more than usual.

Explanation:

A Veterinary  assistant must be well aware about different body languages of cat. Cats show different body postures in different moods.  

i) HAPPY CAT- A happy cat returns our gaze with a blink an eye and there will be a dilation in the eye that indicates happiness and tail will be relaxed.

ii) AGGRESSIVE CAT- An aggressive cat can both be defensive and offensive. Offensive body language includes- stiff and straight leg, lowered stiff tail and a defensive language includes- Crouching of body and eyes completely dilated.

iii) ANGRY CAT- Angry cat has a rigid posture, growls and make its body curled up and make itself look large.

iv) DEPRESSED CAT- Depressed cats hold its ear back and make their fur stand at the end, they tuck their tail and sleeps more than usual.

6 0
3 years ago
The observation that NMDA receptor blockade interferes with performance in the Morris water maze provides an example of a ______
AnnyKZ [126]

The observation that NMDA receptor blockade interferes with performance in the Morris water maze provides an example of a <u>somatic intervention experiment</u> supporting the connection between LTP and memory.

<h3>What is a somatic intervention experiment?</h3>

Somatic Intervention is a technique that allows you to recognize and interrupt habitual patterns (such as anxiety, anger, stress, or fear), release bodily tension and associated memories, and move forward in a more calm and focused manner.

You will learn a new language through Somatic Intervention.

Thus, the correct option is <u>somatic intervention experiment.</u>

<u></u>

Learn more about somatic intervention

brainly.com/question/9651588

#SPJ1

6 0
2 years ago
2. <br> What organs make up the alimentary canal?
cluponka [151]

Explanation:

it consists of mouth, pharynx, gullet, stomach, small intestine, large intestine, appendix, colon, rectum, and anus.

All these parts are found in most vertebrates

5 0
2 years ago
Other questions:
  • Which kingdom is completely composed of unicellular organisms that are prokaryotic?
    7·1 answer
  • How did lamarck propose that species change over time?
    15·2 answers
  • When you are ill with a cold, you fix a bowl of chicken noodle soup to eat to feel better. what factor drives your food choice i
    10·1 answer
  • Why is complementary base pairing important in DNA structure?
    11·1 answer
  • What effects the reaction between hydrogen peroxide and hydrochloric have on liver
    12·1 answer
  • PLEASE HURRY
    12·2 answers
  • What is an example of biological augmentation this is being used today?
    7·2 answers
  • Being able to perform well in a high pressure situation is a natural stress response that releases extra hormones.
    13·2 answers
  • 15. Brown eyes (B) are dominant over blue eyes (b).
    12·1 answer
  • The virtually universal decline in near vision in middle adulthood is called __________.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!