1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Maru [420]
3 years ago
14

A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT…

Biology
1 answer:
padilas [110]3 years ago
4 0

Answer:

Explanation:

a. The template strand is:

ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT

The coding strand is

TGCCGTTCTAGGGTGGGATTAGTCTGGCATGGTAAGTGGAGGA

The sequence encoding the five amino acids is: 3' CTA-ATC-AGA-CCG-TAC-CAT 5'

b. 5' AUG-GUA-CGG-UCU-GAU-UAG 3'

c. N terminus Met-Val-Arg-Ser-Asp C terminus

d. GGAGGA

e. The shine Delgarno sequence as a mRNA binding site for mRNA's binding to the small subunit ribosome.

You might be interested in
Which cellular structures are needed for cellular respiration? Why?
Aliun [14]

Answer:

Mitochondria The eukaryotic cell structure where cellular respiration occurs because they are are organelles whose membranes are specialized for aerobic respiration.

4 0
3 years ago
What are the characteristics of shifting cultivation?
ki77a [65]
It should be purpose, inputs, capital, labor, and produce
7 0
3 years ago
Read 2 more answers
If the area of the brain known as the _____ were severed, then the two sides of the brain would not be able to communicate with
Fed [463]
Answer chooses will help .
4 0
3 years ago
If you are in a chronic state of anxiety but also suffer from moment of sudden, intense fear you are problably suffering. From
ikadub [295]

Generalized Anxiety Disorder

6 0
4 years ago
The facial nerve (cn vii) passes through the opening in the temporal bone called the?
aleksklad [387]

The facial nerve (cn vii) passes through the opening in the temporal bone called the stylomastoid foramen.

<h3>Stylomastoid foramen:</h3>

The foramen between the styloid and mastoid processes of the temporal bone of the skull is known as the stylomastoid foramen. It serves as the facial canal's terminus and carries the facial nerve and stylomastoid artery. Bell's palsy may be brought on by facial nerve irritation in the stylomastoid foramen. An unexplained episode of facial muscular paralysis or weakening is known as Bell's palsy. Over the course of 48 hours, it gets worse suddenly.

The stylomastoid foramen is where the 7th cranial nerve leaves the skull and enters the parotid gland at its deep surface. The nerve splits into two major branches, the temporofacial branch, and the cervicofacial branch, right next to the parotid duct.

Learn more about temporal bone here:

brainly.com/question/21825895

#SPJ4

6 0
2 years ago
Other questions:
  • Arid and semiarid lands are prone to desertification because c. The precipitation cannot meet the growing demand for water or d.
    13·1 answer
  • Bipolar neurons are commonly ________.
    5·1 answer
  • Which of the following is the main evidence of life in the early universe
    12·2 answers
  • What happens when I nerve impulse reaches the end of an axon
    14·1 answer
  • Solve 3x-8=-2 then once you find the value of x, substituted it into x-6
    6·1 answer
  • Based on the graph, which of these conclusions is correct? (2 points)
    11·1 answer
  • Which one of the following linkage, links glucose and fructose molecule in making sucrose?
    14·1 answer
  • Pick the odd one out from each of the groups given below on the basis of respiratory organs. Give
    10·2 answers
  • Do all hardwood trees lose their leaves in winter
    14·1 answer
  • Please?!<br> How many strands do RNA have?
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!