1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
JulijaS [17]
3 years ago
13

Which of the following is NOT a main type of community structure?

Biology
2 answers:
Digiron [165]3 years ago
6 0
The answer is stable.
dem82 [27]3 years ago
3 0
I think the answer is none of the above.
You might be interested in
In the u.s., about what percentage of all food expenditures is now accounted for by meals eaten out?
quester [9]
<span>Eating away from home is playing an increasing large role in the diet and the household budgets of American families. Back in 1970 approximately 26 percent of all food spending was on food away from home; by 2012, that amount had risen to 43 percent. The increase can be attributed to a greater percentage of women employed outside the home, more two-earner households with the resulting higher incomes, as well as more affordable and convenient fast food outlets. The downfall of this statistic is the contribution all that fast food makes to higher levels of obesity and lower dietary nutritional quality.</span>
8 0
3 years ago
Kia is doing an experiment in science lab. She is given a beaker containing 100 g of liquid. The beaker has markings on the side
Anna11 [10]
50grams because 1ml in liquid is equal to 1 gram
8 0
3 years ago
Read 2 more answers
Which organism is the most fit?
pashok25 [27]

tall giraffe

hope it helps...!!!

7 0
2 years ago
Read 2 more answers
Which three type of cells undergo terminal differentiation?
aksik [14]

Answer:

its D

Explanation:

4 0
3 years ago
When human abuse of an ecosystem has changed it so much that the ecosystem can no longer return to its previous state, that ecos
lana [24]
Has reached it's tipping point, I think. Your question was not very specific, so hope this helps.
7 0
3 years ago
Other questions:
  • Which two structures of plants and fungi perform similar functions?
    7·2 answers
  • Which two parts make up the lithosphere?
    14·1 answer
  • Which of the following is not a reason that introduced species are a threat to biodiversity? (1 point)
    9·1 answer
  • Consider the evolution of chordates, organisms with a hollow nerve chord. Choose the organism most closely related to humans.
    13·2 answers
  • Can anyone help me with my homework
    7·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • What is the source of food for germinating seed ?​
    9·1 answer
  • Study this unusual food chain. What could ‘P’ represent?
    9·1 answer
  • How does the Giant tube Worm contribute to the deep-sea food web?
    5·1 answer
  • The proteases involved in initiating and carrying out programmed cell death are called.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!