A term that describes the position of the stomach with respect to the lungs is inferior.
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Optimization refers to the activity of making the most or best efficient use of a resource of situation. Optimization suggests that it is probable to sustain performance in some areas via spontaneous practice and the application of new technology.
The older adults get involved in numerous sexual activities, companionship is essential to age individuals. The optimization in older adults’ sexual activity can be expressed by getting involved in more kissing, cuddling, and fantasizing in comparison to intercourse for satisfying the sexual activity.
Salt water
sand and water
vinegar
this next one is for CEMENT
Concrete is a heterogeneous<span> (composite) material consisting of </span>cement<span>, water, fine aggregates and coarse aggregates. ... Otherwise it is a </span>heterogeneous<span> material.</span>Cement<span> may be called a </span>homogeneous<span> material. But concrete is not.</span>
