1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elis [28]
3 years ago
8

Select all that apply.

Biology
2 answers:
N76 [4]3 years ago
8 0
<span>Distinguishable components and particles that may settle (but don't have to) are characteristics of heterogeneous mixtures.
Small particles and evenly distributed components are characteristics of homogeneous mixtures, while the proportions of the components do not affect this distinction. </span>
Andrei [34K]3 years ago
4 0

Distinguishable components and particles that may settle is the correct answer

You might be interested in
Why ribosomes are called protein factory
Ivenika [448]
More information please
5 0
3 years ago
Which part of your brain receives information as to whether you are moving your legs? limbic system motor cortex somatosensory c
Snowcat [4.5K]
What are the choices?

6 0
3 years ago
What is the role of chlorophyll in photosynthesis
horsena [70]

Chlorophyll captures light energy from the sun to produce glucose

7 0
3 years ago
Describe what will occur the population if it increases in number when food is scarce?
mote1985 [20]

Answer:

more people will die

Explanation:

If you have a big population and little food mor peple will die.

4 0
3 years ago
Read 2 more answers
Find the odd one and write the features of others
Stells [14]

Answer:

1) <em>Ribosome</em>

<em>2</em><em>)</em><em> </em><em>heart</em>

<em>3</em><em>)</em><em> </em><em>Robert</em><em> </em><em>Hooke</em><em>. </em><em>-</em><em>></em><em> </em><em>discovered</em><em> </em><em>the</em><em> </em><em>cell </em>

<em> </em><em> </em><em> </em><em> </em><em>M </em><em>J </em><em>Schleiden</em><em> </em><em> </em><em>-</em><em>></em><em> </em><em>all </em><em>living</em><em> </em><em>organisms</em><em> are</em><em> </em><em>made</em><em> </em><em>up</em><em> of</em><em> </em><em>cells </em>

<em> </em><em> </em><em> </em><em> </em><em>Rudolf</em><em> </em><em>virchow</em><em> </em><em>-</em><em>></em><em> </em><em>new </em><em>cell</em><em> </em><em>are</em><em> </em><em>arises</em><em> </em><em>only</em><em> </em><em>from</em><em> </em><em>pre </em><em>existing</em><em> </em><em>cells</em>

<em>4</em><em>)</em><em> </em><em>plants</em><em> </em><em>cell</em>

4 0
3 years ago
Other questions:
  • Approximately 60% of human genes are also found in fruit flies. About 97.5% of human genes are also found in mice. What does thi
    13·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Molecules that do not contain carbon Are <br> called in organic true or false
    10·2 answers
  • Why are people with sickle-cell traits resistant to malaria
    7·1 answer
  • A wild-type chromosome can be represented as ABC[*]DEFGH, and from this a chromosomal aberration arises that can be represented
    9·1 answer
  • Which of these methods of waste management is most likely to release heavy metals and other toxins into the air?
    12·2 answers
  • Why is freedom a concern for creationists?
    12·1 answer
  • Why is a large number of egg cells not a tissue?
    15·2 answers
  • What is the twisted ladder shape of the DNA called?
    6·2 answers
  • Somebody help me so I can give y’all some points
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!