1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Iteru [2.4K]
3 years ago
11

What super hero had a change or mutation occur in their DNA that gave them their super power?

Biology
2 answers:
Citrus2011 [14]3 years ago
4 0

Answer:

its answer is wolverine.

12345 [234]3 years ago
3 0

Answer: wolverine

Explanation:

You might be interested in
Why are leaves green?
Andre45 [30]
Because of the natural process of photosynthesis that always begins by absorbing light from the sun through proteins. And these reaction centres contain green chlorophyll pigments.
7 0
3 years ago
Read 2 more answers
What is the difference between an intron and an exon?
Nat2105 [25]
<span>Introns are segments of DNA that do not code of any specific amino acid they stay in the nucleus.



Exons are segments of DNA that do code for amino acids(protein) & leave the nucleus to be translated.</span>
4 0
4 years ago
During asexual reproduction, does the organism NEED to make a copy of two organisms or can it just be one?
zheka24 [161]
I have put a table is this helps!

6 0
3 years ago
The rain shadow effect refers to. A.more sunlight on the windward side of mountain ranges more. B. sunlight on the leeward side
bearhunter [10]

Answer: b

Explanation:

5 0
3 years ago
Please I need help with this
barxatty [35]
TAAGCCGATAAATGCTAACGGTA
6 0
3 years ago
Other questions:
  • Why do doctors try removing the tumors from the body
    14·1 answer
  • What does the acronym MBOs stand for? What cell type are they present in?
    14·1 answer
  • Information travels throughout the corona radiata to other parts of the brain via what kind of structures
    13·1 answer
  • When people have their gallbladders removed their bodies no longer
    5·1 answer
  • ¿cual es la importancia de la biologia en la actualidad?
    15·1 answer
  • Which 3 elements are found in all organic compounds that living things need?
    14·1 answer
  • An important part of topsoil is
    13·1 answer
  • Qué Ciencias participan en el estudio de los niveles de organización de los seres vivos?Qué Ciencias participan en el estudio de
    5·1 answer
  • How are members of Domain Eukarya different from members of Domain Bacteria?
    5·1 answer
  • Many farmers currently grow genetically engineered crops. What would be an argument against the use of genetic engineering in
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!