Plants include familiar types such as trees, herbs, bushes, grasses, vines, ferns, mosses, and green algae.
8 ways we use plants in everyday life...
- Upset Stomachs. We use mint to cure upset stomachs. ...
- 10 ways we use plants in everyday life... Chelsea Kay. ...
- Oxygen. Plants give us oxygen, and we give them carbon dioxide. ...
- Aloe. We use trees for heat, such as burning fire wood. ...
- Clothes. We use cotton to make clothes. ...
- Lumber. Cotton plants. ...
- Tea. Oak trees. ...
- Paper.
<h3>Hope it helps </h3>
Explanation:
Pectoralis muscle, any of the muscles that connect the front walls of the chest with the bones of the upper arm and shoulder.
- There are two such muscles on each side of the sternum (breastbone) in the human body:
1. pectoralis major and
2. pectoralis minor.
Which of the following helps ensure groups access to resource it needs for survival? D- Territorial behavior
Hope This Helps :)
Answer:
TACTTCGAGAAAACCAACGAAAAGTGGTAA
Explanation:
Transcription is the process by which a strand of DNA is copied into mRNA.
Remember that in mRNA, U (Uracil) bonds with A (Adenine).
Hope that helps.
Answer:
The answer is D) experiment
Explanation:
the only answer on here that changes multiple times is an experiment.
