1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
jenyasd209 [6]
3 years ago
15

Ancient rift valleys and deep caves often contain human fossils that can provide clues about human evolution and the lives of ou

r ancestors. What do we call an anthropologist who examines just the human evolutionary aspect of fossils?
Biology
1 answer:
Greeley [361]3 years ago
5 0

Answer:

The options

a. prehistoric archaeologist

b.archaeologist

c. Paleoanthropologist

d. paleoprimatologist

The CORRECT ANSWER IS c.

c. .paleoanthropologist

Explanation:

a. Prehistoric archaeology❌

It is the study of the previous times before historical records were used or established. It examines all the pre-urban societies of the world. It possess some unique activities and processes for evaluating material remains so that archaeologists can 'rebuild its ecological settings.

b. Archaeology, or archeology❌

It deals with the study of human processes via the recollection and evaluating of material culture. Its archaeological record employs the use of artifacts, architecture, biofacts or ecofacts and cultural landscapes.

c. Paleoanthropologist✔✔✔

Is the study of the origins and predecessors of the modern day human species, with the aid of fossils and several remnant. It deals with the study of extinct individuals of the genus Homo sapiens via its fossil remains.

d. paleoprimatology ❌

It is the study of ancient (majorly extinct) primates.

You might be interested in
What is the complementary DNA of TACCGGATGCCAGATCAAATC?
Liono4ka [1.6K]

Answer:

ATGGCCTACGGTCTAGTTTAG

Explanation:

A=T

C=G

G=C

T=A

This is the key to finding a complementary <u>DNA strand</u>.

7 0
3 years ago
One possible reason for the rise in the average air temperature at the Earth's surface is that
Evgesh-ka [11]

Answer:

cimate change

4 0
2 years ago
10:<br>34Mwhat is biology ​
amid [387]

its the study of living things and living organisms

7 0
3 years ago
________ are cells that make up the brain and spinal cord and transmit electrical signals from receptor to effectors.
Dafna11 [192]
I think the answer here is neurons, the nerve cells
3 0
3 years ago
The
exis [7]
It should be cell wall
4 0
4 years ago
Other questions:
  • Do prokaryote And eukaryotes and viruses have liquid cytoplasm
    10·1 answer
  • Drag each label into the appropriate position to indicate whether each given item is related to carbohydrates, proteins, or lipi
    15·1 answer
  • A chemistry student attempts to answer the following question: How many liters of carbon dioxide will be produced if 235g of oxy
    8·1 answer
  • A researcher has a petri dish containing several species of bacteria, but no viruses. She notices that the population of E. coli
    10·1 answer
  • Many functions in the body are controlled by
    15·1 answer
  • Which two systems are the kidney, bladder, colon, stomach, and small intestines associated with?
    6·2 answers
  • Fitz loves growing flowers for his mom and friends. Her favorite flowers, roses, are red roses(RR), blue roses (R’R’), and purpl
    10·1 answer
  • Outline the general life cycle of a plants..
    5·2 answers
  • 20 Cashap For every answer
    11·1 answer
  • Which organelle serves as Cell City's police? (This is an analogy)
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!