1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ilia_Sergeevich [38]
2 years ago
11

What is the sensory drive hypothesis?

Biology
1 answer:
In-s [12.5K]2 years ago
4 0
The sensory drive hypothesis predicts that divergent adaptation in sensory and signalling systems to different environments can cause premating isolation between populations.
You might be interested in
Suppose your friend investigated the color of pea pods and concluded that green pods (G) were dominant over yellow pods (g). Wha
s344n2d4d5 [400]
I honestly do not know sorry
8 0
2 years ago
A relationship in which one species kills and consumes another species is known as
HACTEHA [7]
Predation is a biological interaction where one organism, the predator, kills and eats another organism, its prey
6 0
3 years ago
Read 2 more answers
What is the definition of pigment in biology?
choli [55]

NOUN

the natural coloring matter of animal or plant tissue.

VERB

(pigmented)

color (something) with or as if with pigment.

"pigmented areas such as freckles"


3 0
3 years ago
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
Over the past few decades,earth scientist have developed the theory of plate tectonics.Why is this theory useful?
mrs_skeptik [129]

we know where earthquakes occur the most so we know where to not settle. This also helps explain the creation of the earth.

3 0
3 years ago
Read 2 more answers
Other questions:
  • Charles Darwin developed his theories of evolution based on wildlife observations on which famous islands of Ecuador?
    11·2 answers
  • If the sequence of nitrogenous bases in one strand of dna is gta-gca, the sequence of bases on its complementary dna strand woul
    11·1 answer
  • Which of the following adaptions will help a plant survive in the desert?
    10·1 answer
  • is it possible to get pregnant a woman if she have a very small egg cell? in comparison a normal egg cell would be like a size o
    10·2 answers
  • How does modern genetic modification of foods differ from selective breeding?
    10·1 answer
  • What is the function of molecules for DNA gyrase
    9·2 answers
  • Whoever answers I will mark brainlest
    11·1 answer
  • Your school uses stacks of paper every year for printing test papers and worksheets that students later submit. After the test p
    6·2 answers
  • Please answerrrrrr help plsss
    5·1 answer
  • Can someone please help me with this I’ll give u brain list just please !
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!