Answer:
1.mRNA- ATGAAAAGGTCCGTGGGAACTAAACAACACTAA
2.MRNA- ATGAAAACGGTCCGTGGGAACTAAACAACACTAA
3. ??
4. It will affect the protein so the leg wont have enough protein or have too much.
Explanation:
Oryza Sativa is the scientific name for rice
lesser
Explanation:
Reykjavik the capital city of Iceland heats its buildings using geothermal energy sources at a cost that is lesser of what it would be if oil were used.
In all ramification, the use of geothermal energy sources is far more preferable and better than using fossil fuels like oil.
- Geothermal energy is energy from within the earth
- It is natural and renewable source of energy.
- The cost of product is very low
- It has little to no impact on the environment as well.
- They are usually found where magma pockets are close to the surface
learn more:
Renewable source of energy brainly.com/question/2948717
#learnwithBrainly
A dragonfly in its radical final moult, metamorphosing from an aquatic nymph to a winged adult.
In biology, moulting (British English), or molting (American English), also known as sloughing, shedding, or in many invertebrates, ecdysis, is the manner in which an animal routinely casts off a part of its body (often, but not always, an outer layer or covering), either at specific times of the year, or at specific points in its life cycle.
Moulting can involve shedding the epidermis (skin), pelage (hair, feathers, fur, wool), or other external layer. In some groups, other body parts may be shed, for example, wings in some insects or the entire exoskeleton in arthropods.