1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
postnew [5]
3 years ago
11

In what way are lungs and gills similar

Biology
2 answers:
pentagon [3]3 years ago
6 0
While lungs breathe in oxygen from the air, gills get oxygen from water. Gills are external while lungs are internal.
Ne4ueva [31]3 years ago
5 0

The similarities between gills and lungs are as follows

Both organs are utilized to exhale oxygen.

Both organs are largely furnished with blood capillaries which helps to transport oxygen and carbon dioxide.

Both Gills and lungs can work mutually in animals like Dolphins.

You might be interested in
Look at the graphs and choose the correct statement describing the relationship between BMR (basal metabolic rate) and body mass
Paladinen [302]

Answer:

Small mammals have lower BMR, but use more calories per kilogram than large mammals.

7 0
3 years ago
Population contains short and tall plants. the short not able to compete with tall plants for sunlight. The ones are more suscep
AVprozaik [17]
The short plants<span> are </span>not able<span> to </span>compete<span> with </span>tall plants<span> for </span>sunlight<span>. ... The </span>tall plants, however, aremore susceptible<span> to </span>wind damage<span>. Which </span>type<span> of </span>selection<span> are the </span>plants experiencing? directionalselection<span> ... They are believed to have come from </span>one<span> common ancestor and just become </span>more<span> and</span>more<span> different due to .</span>
8 0
3 years ago
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
3 years ago
Please help me answer this question? Thank you!
erik [133]
Wuwheuwuwhwhw. The answer is c
6 0
4 years ago
When gas oil and coal are burned ____ is added to the atmosphere
Nady [450]
Carbon dioxide is released into the air... welcome if right :3 plz put a thx if im right
5 0
3 years ago
Other questions:
  • Colored aleurone in the kernels of corn is due to the dominant allele R. The recessive allele r, when homozygous, produces color
    8·1 answer
  • Please help me answer this question!! ~50 Points!~
    11·1 answer
  • the trait for flower color is highly variable among certain species of rose plants leading to the formation of flowers of differ
    8·1 answer
  • Which statement best describes the relationship between photosynthesis and cellular respiration?
    11·2 answers
  • brainly!!! can someone help me turn this into an if then statement for my lab??? i am really stuck and can include more info abo
    8·1 answer
  • Anyone ?? This is a timed this
    5·2 answers
  • What force works against gravity as water infiltrates the soil and moves underground ?
    14·2 answers
  • Which is an example of as-xual reproduction by cloning?
    13·2 answers
  • 1. What interactions affect protons in an atomic nucleus? More than one answer may be correct.
    15·1 answer
  • 1
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!