1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andrey2020 [161]
3 years ago
7

Witch type of pollution includes CFCs smog?

Biology
2 answers:
AnnyKZ [126]3 years ago
5 0
Your answer will be air pollution.
LenaWriter [7]3 years ago
3 0
Air Pollution.........
You might be interested in
Which land ecosystem depends on a good root system?
Leto [7]
It's letter C :) I think..
6 0
3 years ago
Many species have embryos that look similar to one another and develop similar structures. Refer to the picture above. During th
Pavel [41]

Answer:

A) Divergent evolution because all of the species have similar structures during the first stage of development.

Explanation:

5 0
3 years ago
Read 2 more answers
Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0
3 years ago
Patrick wants to trace the progress of development of a frog embryo. Which technique will he use for this?
Oduvanchick [21]
It should be C! (: Fate mapping because it is used do dermine tissue linage!
While Differentiation is used when one cell type changes from one cell to another.
When it comes to the process an undifferentiated cell is already programmed to become a specific cell type by following a specified path towards cell differentiation.
I hope all is well, and you pass! (: Good luck, rockstar! If you need any further information, let me know. (:
4 0
2 years ago
The question is What serves as the ultimate control center of the body overseeing all communication among the organ systems?
AnnZ [28]

Answer:

nervous system

Explanation:

the cns oversees every action our body does

4 0
3 years ago
Other questions:
  • Describe the connection between fossil fuel burning, the melting of polar ice, and the rising of global sea levels.
    13·1 answer
  • True or False<br><br>Genetics account for all differences in animals.
    7·1 answer
  • Processes that determine heredity and contribute to genetic variationMeiosis guarantees that in a sexual life cycle, offspring w
    14·1 answer
  • The table shows the energy that is stored in three types of organic molecules. Energy Storage in Humans A 4-column table with 3
    6·2 answers
  • What is the driving force for the movement of the lithospheric plates? A unequal distribution of heat in the oceans B unequal di
    6·2 answers
  • Which of the following is accurate? Group of answer choices Any damaged ecosystem can be completely restored. Our understanding
    9·1 answer
  • Why does the human body respond to stimuli
    13·1 answer
  • Which of the following statement is correct about about the hierarchy of the taxonomic system currently used to classify organis
    5·1 answer
  • - is a covalent compound stimulates the pleasure areas in our brain making us feel good ,speed up the activity in brain and keep
    8·2 answers
  • Sequence three probable steps of fossil fish formation?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!