1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
s2008m [1.1K]
3 years ago
9

How do organic molecules move through the forest ecosystem

Biology
1 answer:
svetlana [45]3 years ago
7 0

Answer:

If i remember correctly, i'll explain.

Explanation:

So (optional) we burn fossil fuels which plants absorb carbon from the atmosphere and the soil, other animals or humans eat them, we die and the organic compounds return back to the soil or the earth. Hope this helps but i may be wrong.

You might be interested in
2018 liu comparative study of phrenic and partial ulnar nerve transfers for elbow flexion after upper brachial plexus avulsion a
aniked [119]

The broadly used nerve switch sources for elbow flexion in sufferers with pinnacle brachial plexus avulsion UBPA encompass partial ulnar nerve phrenic nerve and intercostal nerves.

A retrospective evaluation of twenty-one sufferers treated with phrenic and partial ulnar nerve transfers for elbow flexion after UBPA become executed.

In the phrenic nerve transfer institution, the phrenic nerve changed into transferred to the anterolateral package of the anterior department of the upper trunk; inside the partial ulnar nerve switch corporation, one fascicle of the ulnar nerve became transferred to the biceps department. The British scientific studies Council MRC grading machine, the attitude of elbow flexion, electromyography EMG, and the Disabilities of the Arm, Shoulder, and Hand dash questionnaire scoring were used to evaluate the recovery of elbow flexion at least three years postoperatively.

The performance of motor features in phrenic nerve switch establishments come to be eighty- percentage while it modified to 80 percentage in partial ulnar nerve transfer enterprise. The exceptional costs of the angle of elbow flexion were sixty-four percent and seventy percentage in phrenic and partial ulnar nerve transfer businesses, respectively.

Learn more about Phrenic and partial ulnar here:-brainly.com/question/5909273

#SPJ4

4 0
1 year ago
Snow is a form of what
abruzzese [7]
Snow is precipitation in the form of ice crystals. It originates in clouds when temperatures are below the freezing point (0 degrees Celsius, or 32 degrees Fahrenheit), when water vapor in the atmosphere condenses directly into ice without going through the liquid stage.
6 0
3 years ago
The decrease in height that can occur in older adulthood results mainly from change in what body area
svet-max [94.6K]
The decrease in height is caused by the discs between vertebrae compressing.
6 0
3 years ago
What is DNA and its structure
DaniilM [7]

Answer:

Deoxyribonucleic acid or DNA is a molecule that contains the instructions an organism needs to develop, live and reproduce. These instructions are found inside every cell, and are passed down from parents to their children.

DNA structure --> DNA is made up of molecules called nucleotides.

Explanation:

I hope this helps!  :}

6 0
3 years ago
Read 2 more answers
How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
Mariana [72]

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

6 0
4 years ago
Other questions:
  • Write a paragraph describing how water changes state.
    8·1 answer
  • A person with Type O blood has the following alleles for blood group:
    13·2 answers
  • Which one of the following pollutants is responsible for the increase in skin cancer?
    6·1 answer
  • A neuron receives a number of EPSPs from many different neurons. If a sufficient number of EPSPs are received, the neuron respon
    7·1 answer
  • CORRECT ANSWER GETS BRAINLIEST
    11·2 answers
  • When the deer's gametes devide by mitosis how many chromosomes will each daughter cell have?
    8·1 answer
  • The variations in the features of the tortoise populations on Albemarle and Abingdon islands are examples of __________.
    10·2 answers
  • The diagram shows the structure of starch, a complex carbohydrate. What best describes the relationship between starch and gluco
    6·1 answer
  • The 2011 earthquake triggered a ... Question 3 options: hurricane volcano tsunami sand storm
    13·1 answer
  • I GIVE BRAINLIST ON ALL MY QUESTIONS!!
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!