1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
motikmotik
3 years ago
7

What is the particle called that wind carries?

Biology
1 answer:
Sergio039 [100]3 years ago
3 0
The general term is wind erosion. When this occurs in soil<span>, it is called </span>deflation<span>.</span>
You might be interested in
Sugar is a component of which of the following?<br><br> carbohydrates<br> lipids<br> nucleic acids
Jet001 [13]

Answer:

carbohydrates

Explanation:

The white stuff we know as sugar is sucrose, a molecule composed of 12 atoms of carbon, 22 atoms of hydrogen, and 11 atoms of oxygen (C12H22O11). Like all compounds made from these three elements, sugar is a carbohydrate. ... Sucrose is actually two simpler sugars stuck together: fructose and glucose.

4 0
3 years ago
Read 2 more answers
A fetus is the:
Arturiano [62]
The answer is E, it isn’t considered a fetus until the 9th week after conception
5 0
3 years ago
What is the correct sequence of these genes on the X chromosome?
almond37 [142]

Answer:

C

Explanation:

The correct sequence of these Genes on the X chromosome is sc v s (v in the middle)

7 0
3 years ago
Why is it important to maintain a good body image and why we must learn to appreciate our own beauty?​
Hunter-Best [27]

Answer:

You must understand that your body belongs to you. Most of the stuff you see on adverts are all fake. (It's mostly photoshop) Your beautiful no matter what you look like!

Explanation:

Hope this helps!

7 0
3 years ago
Read 2 more answers
How do pioneer species make ecological succession possible on an island formed from a volcanic eruptions
SIZIF [17.4K]

Answer:

The correct option is <em>3. they break down rock into soil in which plants can grow</em>

Explanation:

When a disaster is such huge that even the soil and organic matter get removed from the place, then the succession that will occur in such kind of place will be termed as primary succession. For example, a volcanic eruption or an earthquake.

On the other hand, if after a disaster some of the organic matter remains on the land, then the succession that will occur will be termed as secondary succession. E.g a succession after fire

In primary succession, the pioneer species will be plants that require less soil such as the lichens. The lichens will break down the rocks into the soil and eventually new species of plants will start to grow on the land.

3 0
3 years ago
Other questions:
  • In which stage of the design process does the designer conduct a beta test
    8·1 answer
  • Where in the cell is the tag incorporated into the protein?
    15·1 answer
  • Why is inertia an important concept (piece) to planetary motion?
    6·1 answer
  • Meiosis produces four new cells with ______ the chromosomes as the parent cell. two-thirds one-half one-quarter one-third
    9·1 answer
  • What would have happen to an animal if all of its mitochondria disappeared?
    6·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • The word luminous contains the Latin root lum, which means light. Which of these also contains the Latin root lum?
    12·2 answers
  • Who tried to create a superhuman race?​
    12·2 answers
  • After they investigated further, they discovered that the difference between lactose tolerant and intolerant individuals was due
    7·1 answer
  • Based on the model simulation of the carbon cycle, what happens when you increase the plant biomass?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!