1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Harlamova29_29 [7]
3 years ago
12

Insulin-dependent diabetics depend upon ____________ microorganisms to produce the human protein that they rely upon to uptake g

lucose from their bloodstreams.
Biology
1 answer:
-Dominant- [34]3 years ago
6 0
The answer would be: <span>transgenic
</span>
Bacteria can be altered to produce a specific protein by introducing a sequence of DNA into their genes. This bacteria is called genetically modified bacteria. Bacteria that producing insulin called transgenic because they have genes of other species transplanted on them.
You might be interested in
Humans are dependent on a functioning biosphere and other ecological systems for survival. true or false.
kvv77 [185]

The statement is - True.

The humans, as advanced and developed they may be, can not function and survive without the proper functioning of the biosphere, hydrosphere, atmosphere, geosphere, cryosphere. All of those spheres are crucial in defining the life conditions on our planet, and the human kind, as all other living organisms, is heavily dependent upon them.

Unfortunately, the humans have been interfering a lot in the functioning of this systems, and make it harder and harder for them to function properly, and the interfering with the ecological systems is extremely dangerous as it can have a catastrophic consequences.

6 0
3 years ago
Read 2 more answers
The purpose of Metosis is to
Basile [38]

Answer:

Mitosis is a mechanism in which a single cell separates into two separate cells of daughters. One cell in mitosis? Once splits two similar cells into two. Mitosis is primarily aimed at growth and replacement of depleted cells

Explanation:

7 0
3 years ago
Read 2 more answers
Simon is a 35-year-old lawyer who works in a large law firm in New York City. He’s noticed that since he turned 30, his body see
attashe74 [19]

The answer is c because they are easily destroyed and washed away during food storage preparation

5 0
3 years ago
The original template for the process of protein synthesis is—
SOVA2 [1]

Answer:

I think the answer is gonna be B

6 0
3 years ago
Can a single cell be a living thing? explain
alexandr402 [8]
Yea they actually can and l<span>iving things that are composed of one cell are known as unicellular organisms. Examples of unicellular organisms include amoebas, bacteria and certain fungi. Unicellular organisms are either prokaryotes or eukaryotes.</span>
4 0
3 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • What are biotic factors found in a kitchen
    8·1 answer
  • 3. Which plant organelle carries out photosynthesis and produces the gas?
    10·1 answer
  • What trait most likely helped young angiosperms in this way? plez help
    11·2 answers
  • If a wave is generated in a Slinky® and the wave hits a wall, the reflected wave will be a)erect b)inverted c) neither
    9·2 answers
  • Q2.25. Assume that early in the summer, the only prey available are stoneflies and caddisflies. If the search time for its prefe
    14·1 answer
  • What is an advantage of using totipotent cells instead of pluripotent cells for medical treatments?
    11·2 answers
  • Movement of chromosome segment to a non-homologous chromosome. This type of chromosomal mutation occurs when one chromosome swap
    5·1 answer
  • Help meeeeeeee pleaseeeeeee
    11·1 answer
  • if a person has a genetic mutation which renders them incapable of making chemoreceptors, which sense would be affected?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!