1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Inessa [10]
3 years ago
12

Please help me with this question

Biology
1 answer:
AleksAgata [21]3 years ago
5 0
Gravity .u cannot see gravity but it pulls objects downward
You might be interested in
1. Which of the following is the most appropriate definition of organic compound?
Andreyy89

Answer:

the Answer is A

because organic compound is made up of living things

8 0
3 years ago
Read 2 more answers
Should fracking be used to release natural gas and oil ?
oksian1 [2.3K]

Explanation:

Fracking is the introduction of substances into a formation in order to increase they pore pressure and to increase natural drive of hydrocarbons.

Fracking has several environmental issues associated with it;

  • Fracking leads to air pollution in case of blowout of gas pressure in formations, particles and dusts can become blasted into the environment.
  • Proppants in fluids channeled into formations can lead to ground water contamination.
  • In areas where fracking is done, there might be an exposure to harmful chemicals.
  • Destruction of the natural habitats of animals.
5 0
3 years ago
Once food has been broken down to be used in the cell for energy, what must also happen?
Orlov [11]
Acontece nao sei oque
3 0
4 years ago
What goes into the cell for cr to occur
BARSIC [14]
<span>In the presence of oxygen, one glucose molecule has the energy to make up to 38 ATP. The ATP production is determined by the following steps, (-2 ATP) glycolysis preparatory phase, (7-9 ATP) glycolysis pay-off phase, (5 ATP) oxidative decarboxylation of pyruvate and (20 ATP) Krebs cycle. One glucose which has 38 ATP hence was the summation of all the process mentioned that took place.  All these process take place under the cellular function of cellular respiration.<span>
</span></span>
6 0
3 years ago
Which element does the thyroid need to function properly?
sveticcg [70]
Ok your thyroid gland also contains selenium

7 0
3 years ago
Other questions:
  • Smooth muscles is something called visceral muscle because it.
    11·1 answer
  • What happens after the first stage separates? in a multistage rocket
    14·1 answer
  • Advances in technology have helped many industries, including agriculture. Which agricultural application is most
    13·1 answer
  • What is the element of an atom that has six protons and six electrons
    8·1 answer
  • Question 14 <br><br> Answer correctly plz.
    5·2 answers
  • UAC)
    10·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Which is the function of the ribosoma???
    14·2 answers
  • 5. Which offspring could not arise from the parent cells with the chromosomes shown below? Assume crossovers can occur between c
    8·2 answers
  • Which does the termination of translation require?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!